self presentation

How it works

Transform your enterprise with the scalable mindsets, skills, & behavior change that drive performance.

Explore how BetterUp connects to your core business systems.

We pair AI with the latest in human-centered coaching to drive powerful, lasting learning and behavior change.

Build leaders that accelerate team performance and engagement.

Unlock performance potential at scale with AI-powered curated growth journeys.

Build resilience, well-being and agility to drive performance across your entire enterprise.

Transform your business, starting with your sales leaders.

Unlock business impact from the top with executive coaching.

Foster a culture of inclusion and belonging.

Accelerate the performance and potential of your agencies and employees.

See how innovative organizations use BetterUp to build a thriving workforce.

Discover how BetterUp measurably impacts key business outcomes for organizations like yours.

A demo is the first step to transforming your business. Meet with us to develop a plan for attaining your goals.

• What is coaching?

Learn how 1:1 coaching works, who its for, and if it's right for you.

Accelerate your personal and professional growth with the expert guidance of a BetterUp Coach.

Types of Coaching

Navigate career transitions, accelerate your professional growth, and achieve your career goals with expert coaching.

Enhance your communication skills for better personal and professional relationships, with tailored coaching that focuses on your needs.

Find balance, resilience, and well-being in all areas of your life with holistic coaching designed to empower you.

Discover your perfect match : Take our 5-minute assessment and let us pair you with one of our top Coaches tailored just for you.

Research, expert insights, and resources to develop courageous leaders within your organization.

Best practices, research, and tools to fuel individual and business growth.

View on-demand BetterUp events and learn about upcoming live discussions.

The latest insights and ideas for building a high-performing workplace.

• BetterUp Briefing

The online magazine that helps you understand tomorrow's workforce trends, today.

Innovative research featured in peer-reviewed journals, press, and more.

Founded in 2022 to deepen the understanding of the intersection of well-being, purpose, and performance

We're on a mission to help everyone live with clarity, purpose, and passion.

Join us and create impactful change.

Read the buzz about BetterUp.

Meet the leadership that's passionate about empowering your workforce.

For Business

For Individuals

The self presentation theory and how to present your best self

Jump to section

What does self presentation mean?

What are self presentation goals, individual differences and self presentation.

How can you make the most of the self presentation theory at work?  

We all want others to see us as confident, competent, and likeable — even if we don’t necessarily feel that way all the time. In fact, we make dozens of decisions every day — whether consciously or unconsciously — to get people to see us as we want to be seen. But is this kind of self presentation dishonest? Shouldn’t we just be ourselves?

Success requires interacting with other people. We can’t control the other side of those interactions. But we can think about how the other person might see us and make choices about what we want to convey. 

Self presentation is any behavior or action made with the intention to influence or change how other people see you. Anytime we're trying to get people to think of us a certain way, it's an act of self presentation. Generally speaking, we work to present ourselves as favorably as possible. What that means can vary depending on the situation and the other person.

Although at first glance this may seem disingenuous, we all engage in self-presentation. We want to make sure that we show up in a way that not only makes us look good, but makes us feel good about ourselves.

Early research on self presentation focused on narcissism and sociopathy, and how people might use the impression others have of them to manipulate others for their benefit. However, self presentation and manipulation are distinct. After all, managing the way others see us works for their benefit as well as ours.

Imagine, for example, a friend was complaining to you about   a tough time they were having at work . You may want to show up as a compassionate person. However, it also benefits your friend — they feel heard and able to express what is bothering them when you appear to be present, attentive, and considerate of their feelings. In this case, you’d be conscious of projecting a caring image, even if your mind was elsewhere, because you value the relationship and your friend’s experience.

To some extent, every aspect of our lives depends on successful self-presentation. We want our families to feel that we are worthy of attention and love. We present ourselves as studious and responsible to our teachers. We want to seem fun and interesting at a party, and confident at networking events. Even landing a job depends on you convincing the interviewer that you are the best person for the role.

There are three main reasons why people engage in self presentation:

Tangible or social benefits:

In order to achieve the results we want, it often requires that we behave a certain way. In other words, certain behaviors are desirable in certain situations. Matching our behavior to the circumstances can help us connect to others,   develop a sense of belonging , and attune to the needs and feelings of others.

Example:   Michelle is   a new manager . At her first leadership meeting, someone makes a joke that she doesn’t quite get. When everyone else laughs, she smiles, even though she’s not sure why.

By laughing along with the joke, Michelle is trying to fit in and appear “in the know.” Perhaps more importantly, she avoids feeling (or at least appearing) left out, humorless, or revealing that she didn’t get it — which may hurt her confidence and how she interacts with the group in the future.

To facilitate social interaction:

As mentioned, certain circumstances and roles call for certain behaviors. Imagine a defense attorney. Do you think of them a certain way? Do you have expectations for what they do — or don’t — do? If you saw them frantically searching for their car keys, would you feel confident with them defending your case?

If the answer is no, then you have a good idea of why self presentation is critical to social functioning. We’re surprised when people don’t present themselves in a way that we feel is consistent with the demands of their role. Having an understanding of what is expected of you — whether at home, work, or in relationships — may help you succeed by inspiring confidence in others.

Example:   Christopher has always been called a “know-it-all.” He reads frequently and across a variety of topics, but gets nervous and tends to talk over people. When attending a networking event, he is uncharacteristically quiet. Even though he would love to speak up, he’s afraid of being seen as someone who “dominates” the conversation. 

Identity Construction:

It’s not enough for us to declare who we are or what we want to be — we have to take actions consistent with that identity. In many cases, we also have to get others to buy into this image of ourselves as well. Whether it’s a personality trait or a promotion, it can be said that we’re not who   we   think we are, but who others see.

Example:   Jordan is interested in moving to a client-facing role. However, in their last performance review, their manager commented that Jordan seemed “more comfortable working independently.” 

Declaring themselves a “people person” won’t make Jordan’s manager see them any differently. In order to gain their manager’s confidence, Jordan will have to show up as someone who can comfortably engage with clients and thrive in their new role.

We may also use self presentation to reinforce a desired identity for ourselves. If we want to accomplish something, make a change, or   learn a new skill , making it public is a powerful strategy. There's a reason why people who share their goals are more likely to be successful. The positive pressure can help us stay accountable to our commitments in a way that would be hard to accomplish alone.

Example:   Fatima wants to run a 5K. She’s signed up for a couple before, but her perfectionist tendencies lead her to skip race day because she feels she hasn’t trained enough. However, when her friend asks her to run a 5K with her, she shows up without a second thought.

In Fatima’s case, the positive pressure — along with the desire to serve a more important value (friendship) — makes showing up easy.

Because we spend so much time with other people (and our success largely depends on what they think of us), we all curate our appearance in one way or another. However, we don’t all desire to have people see us in the same way or to achieve the same goals. Our experiences and outcomes may vary based on a variety of factors.

One important factor is our level of self-monitoring when we interact with others. Some people are particularly concerned about creating a good impression, while others are uninterested. This can vary not only in individuals, but by circumstances.   A person may feel very confident at work , but nervous about making a good impression on a first date.

Another factor is self-consciousness — that is, how aware people are of themselves in a given circumstance. People that score high on scales of public self-consciousness are aware of how they come across socially. This tends to make it easier for them to align their behavior with the perception that they want others to have of them.

Finally, it's not enough to simply want other people to see you differently. In order to successfully change how other people perceive you, need to have three main skills: 

1. Perception and empathy

Successful self-presentation depends on being able to correctly perceive   how people are feeling , what's important to them, and which traits you need to project in order to achieve your intended outcomes.

2. Motivation

If we don’t have a compelling reason to change the perception that others have of us, we are not likely to try to change our behavior. Your desire for a particular outcome, whether it's social or material, creates a sense of urgency.

3.  A matching skill set

You’ve got to be able to walk the talk. Your actions will convince others more than anything you say. In other words, you have to provide evidence that you are the person you say you are. You may run into challenges if you're trying to portray yourself as skilled in an area where you actually lack experience.

How can you make the most of the self presentation theory at work?

At its heart, self presentation requires a high-level of self awareness and empathy. In order to make sure that we're showing up as our best in every circumstance — and with each person — we have to be aware of our own motivation as well as what would make the biggest difference to the person in front of us.

Here are 6 strategies to learn to make the most of the self-presentation theory in your career:

1. Get feedback from people around you

Ask a trusted friend or mentor to share what you can improve. Asking for feedback about specific experiences, like a recent project or presentation, will make their suggestions more relevant and easier to implement.

2. Study people who have been successful in your role

Look at how they interact with other people. How do you perceive them? Have they had to cultivate particular skills or ways of interacting with others that may not have come easily to them?

3. Be yourself

Look for areas where you naturally excel and stand out. If you feel comfortable, confident, and happy, you’ll have an easier time projecting that to others. It’s much harder to present yourself as confident when you’re uncomfortable.

4. Be aware that you may mess up

As you work to master new skills and ways of interacting with others,   keep asking for feedback . Talk to your manager, team, or a trusted friend about how you came across. If you sense that you’ve missed the mark, address it candidly. People will understand, and you’ll learn more quickly.

Try saying, “I hope that didn’t come across as _______. I want you to know that…”

5. Work with a coach

Coaches are skilled in interpersonal communication and committed to your success. Roleplay conversations to see how they land, and practice what you’ll say and do in upcoming encounters. Over time, a coach will also begin to know you well enough to notice patterns and suggest areas for improvement.

6. The identity is in the details

Don’t forget about the other aspects of your presentation. Take a moment to visualize yourself being the way that you want to be seen. Are there certain details that would make you feel more like that person? Getting organized, refreshing your wardrobe, rewriting your resume, and even cleaning your home office can all serve as powerful affirmations of your next-level self.

Self presentation is defined as the way we try to control how others see us, but it’s just as much about how we see ourselves. It is a skill to achieve a level of comfort with who we are   and   feel confident to choose how we self-present. Consciously working to make sure others get to see the very best of you is a wonderful way to develop into the person you want to be.

Transform your life

Make meaningful changes and become the best version of yourself. BetterUp's professional Coaches are here to support your personal growth journey.

Allaya Cooks-Campbell

With over 15 years of content experience, Allaya Cooks Campbell has written for outlets such as ScaryMommy, HRzone, and HuffPost. She holds a B.A. in Psychology and is a certified yoga instructor as well as a certified Integrative Wellness & Life Coach. Allaya is passionate about whole-person wellness, yoga, and mental health.

Impression management: Developing your self-presentation skills

6 presentation skills and how to improve them, how to make a presentation interactive and exciting, how to give a good presentation that captivates any audience, how self-knowledge builds success: self-awareness in the workplace, self-management skills for a messy world, how remote work will redefine future careers, according to gen z, 80 affirmations for confidence: combatting self-doubt with self-love, are you being passed over for a promotion here’s what to do, how to not be nervous for a presentation — 13 tips that work (really), what happened when a surgeon hired a coach, ready to be inspired here are 11 self-motivation examples, i stopped having dead people's goals, 18 questions to ask in a performance self-evaluation, getting passed over for a promotion is tough. here's how to handle it, love them or hate them, meetings promote social learning and growth, why we need to reframe potential into readiness, remastering people strategy to future-proof organizational success, stay connected with betterup, get our newsletter, event invites, plus product insights and research..

3100 E 5th Street, Suite 350 Austin, TX 78702

• Platform Overview
• Integrations
• Powered by AI
• BetterUp Lead™
• BetterUp Manage™
• BetterUp Care®
• Sales Performance
• Diversity & Inclusion
• Case Studies
• Why BetterUp?
• About Coaching
• Find your Coach
• Career Coaching
• Communication Coaching
• Life Coaching
• News and Press
• Leadership Team
• Become a BetterUp Coach
• BetterUp Labs
• Center for Purpose & Performance
• Leadership Training
• Business Coaching
• Contact Support
• Contact Sales
• Privacy Policy
• Acceptable Use Policy
• Trust & Security
• Cookie Preferences

Impression Management: Erving Goffman Theory

Charlotte Nickerson

Research Assistant at Harvard University

Undergraduate at Harvard University

Charlotte Nickerson is a student at Harvard University obsessed with the intersection of mental health, productivity, and design.

Learn about our Editorial Process

Saul Mcleod, PhD

Editor-in-Chief for Simply Psychology

BSc (Hons) Psychology, MRes, PhD, University of Manchester

Saul Mcleod, PhD., is a qualified psychology teacher with over 18 years of experience in further and higher education. He has been published in peer-reviewed journals, including the Journal of Clinical Psychology.

Olivia Guy-Evans, MSc

Associate Editor for Simply Psychology

BSc (Hons) Psychology, MSc Psychology of Education

Olivia Guy-Evans is a writer and associate editor for Simply Psychology. She has previously worked in healthcare and educational sectors.

On This Page:

• Impression management refers to the goal-directed conscious or unconscious attempt to influence the perceptions of other people about a person, object, or event by regulating and controlling information in social interaction.
• Generally, people undertake impression management to achieve goals that require they have a desired public image. This activity is called self-presentation.
• In sociology and social psychology, self-presentation is the conscious or unconscious process through which people try to control the impressions other people form of them.
• The goal is for one to present themselves the way in which they would like to be thought of by the individual or group they are interacting with. This form of management generally applies to the first impression.
• Erving Goffman popularized the concept of perception management in his book, The Presentation of Self in Everyday Life , where he argues that impression management not only influences how one is treated by other people but is an essential part of social interaction.

Impression Management in Sociology

Impression management, also known as self-presentation, refers to the ways that people attempt to control how they are perceived by others (Goffman, 1959).

By conveying particular impressions about their abilities, attitudes, motives, status, emotional reactions, and other characteristics, people can influence others to respond to them in desirable ways.

Impression management is a common way for people to influence one another in order to obtain various goals.

While earlier theorists (e.g., Burke, 1950; Hart & Burk, 1972) offered perspectives on the person as a performer, Goffman (1959) was the first to develop a specific theory concerning self-presentation.

In his well-known work, Goffman created the foundation and the defining principles of what is commonly referred to as impression management.

In explicitly laying out a purpose for his work, Goffman (1959) proposes to “consider the ways in which the individual in ordinary work situations presents himself and his activity to others, the ways in which he guides and controls the impression they form of him, and the kind of things he may or may not do while sustaining his performance before them.” (p. xi)

Social Interaction

Goffman viewed impression management not only as a means of influencing how one is treated by other people but also as an essential part of social interaction.

He communicates this view through the conceit of theatre. Actors give different performances in front of different audiences, and the actors and the audience cooperate in negotiating and maintaining the definition of a situation.

To Goffman, the self was not a fixed thing that resides within individuals but a social process. For social interactions to go smoothly, every interactant needs to project a public identity that guides others’ behaviors (Goffman, 1959, 1963; Leary, 2001; Tseelon, 1992).

Goffman defines that when people enter the presence of others, they communicate information by verbal intentional methods and by non-verbal unintentional methods.

According to Goffman, individuals participate in social interactions through performing a “line” or “a pattern of verbal and nonverbal acts by which he expresses his view of the situation and through this his evaluation of the participants, especially himself” (1967, p. 5).

Such lines are created and maintained by both the performer and the audience. By enacting a line effectively, a person gains positive social value or “face.”

The verbal intentional methods allow us to establish who we are and what we wish to communicate directly. We must use these methods for the majority of the actual communication of data.

Goffman is mostly interested in the non-verbal clues given off which are less easily manipulated. When these clues are manipulated the receiver generally still has the upper hand in determining how realistic the clues that are given off are.

People use these clues to determine how to treat a person and if the intentional verbal responses given off are actually honest. It is also known that most people give off clues that help to represent them in a positive light, which tends to be compensated for by the receiver.

Impression Management Techniques

• Suppressing emotions : Maintaining self-control (which we will identify with such practices as speaking briefly and modestly).
• Conforming to Situational Norms : The performer follows agreed-upon rules for behavior in the organization.
• Flattering Others : The performer compliments the perceiver. This tactic works best when flattery is not extreme and when it involves a dimension important to the perceiver.
• Being Consistent : The performer’s beliefs and behaviors are consistent. There is agreement between the performer’s verbal and nonverbal behaviors.

Self-Presentation Examples

Self-presentation can affect the emotional experience . For example, people can become socially anxious when they are motivated to make a desired impression on others but doubt that they can do so successfully (Leary, 2001).

In one paper on self-presentation and emotional experience, Schlenker and Leary (1982) argue that, in contrast to the drive models of anxiety, the cognitive state of the individual mediates both arousal and behavior.

The researchers examine the traditional inverted-U anxiety-performance curve (popularly known as the Yerkes-Dodson law) in this light.

The researchers propose that people are interpersonally secure when they do not have the goal of creating a particular impression on others.

They are not immediately concerned about others’ evaluative reactions in a social setting where they are attempting to create a particular impression and believe that they will be successful in doing so.

Meanwhile, people are anxious when they are uncertain about how to go about creating a certain impression (such as when they do not know what sort of attributes the other person is likely to be impressed with), think that they will not be able to project the types of images that will produce preferred reactions from others.

Such people think that they will not be able to project the desired image strongly enough or believe that some event will happen that will repudiate their self-presentations, causing reputational damage (Schlenker and Leary, 1982).

Psychologists have also studied impression management in the context of mental and physical health .

In one such study, Braginsky et al. (1969) showed that those hospitalized with schizophrenia modify the severity of their “disordered” behavior depending on whether making a more or less “disordered” impression would be most beneficial to them (Leary, 2001).

Additional research on university students shows that people may exaggerate or even fabricate reports of psychological distress when doing so for their social goals.

Hypochondria appears to have self-presentational features where people convey impressions of illness and injury, when doing so helps to drive desired outcomes such as eliciting support or avoiding responsibilities (Leary, 2001).

People can also engage in dangerous behaviors for self-presentation reasons such as suntanning, unsafe sex, and fast driving. People may also refuse needed medical treatment if seeking this medical treatment compromises public image (Leary et al., 1994).

Key Components

There are several determinants of impression management, and people have many reasons to monitor and regulate how others perceive them.

For example, social relationships such as friendship, group membership, romantic relationships, desirable jobs, status, and influence rely partly on other people perceiving the individual as being a particular kind of person or having certain traits.

Because people’s goals depend on them making desired impressions over undesired impressions, people are concerned with the impressions other people form of them.

Although people appear to monitor how they come across ongoingly, the degree to which they are motivated to impression manage and the types of impressions they try to foster varies by situation and individuals (Leary, 2001).

Leary and Kowalski (1990) say that there are two processes that constitute impression management, each of which operate according to different principles and are affected by different situations and dispositional aspects. The first of these processes is impression motivation, and the second is impression construction.

Impression Motivation

There are three main factors that affect how much people are motivated to impression-manage in a situation (Leary and Kowalski, 1990):

(1) How much people believe their public images are relevant to them attaining their desired goals.

When people believe that their public image is relevant to them achieving their goals, they are generally more motivated to control how others perceive them (Leary, 2001).

Conversely, when the impressions of other people have few implications on one’s outcomes, that person’s motivation to impression-manage will be lower.

This is why people are more likely to impression manage in their interactions with powerful, high-status people than those who are less powerful and have lower status (Leary, 2001).

(2) How valuable the goals are: people are also more likely to impress and manage the more valuable the goals for which their public impressions are relevant (Leary, 2001).

(3) how much of a discrepancy there is between how they want to be perceived and how they believe others perceive them..

People are more highly motivated to impression-manage when there is a difference between how they want to be perceived and how they believe others perceive them.

For example, public scandals and embarrassing events that convey undesirable impressions can cause people to make self-presentational efforts to repair what they see as their damaged reputations (Leary, 2001).

Impression Construction

Features of the social situations that people find themselves in, as well as their own personalities, determine the nature of the impressions that they try to convey.

In particular, Leary and Kowalski (1990) name five sets of factors that are especially important in impression construction (Leary, 2001).

Two of these factors include how people’s relationships with themselves (self-concept and desired identity), and three involve how people relate to others (role constraints, target value, and current or potential social image) (Leary and Kowalski, 1990).

Self-concept

The impressions that people try to create are influenced not only by social context but also by one’s own self-concept .

People usually want others to see them as “how they really are” (Leary, 2001), but this is in tension with the fact that people must deliberately manage their impressions in order to be viewed accurately by others (Goffman, 1959).

People’s self-concepts can also constrain the images they try to convey.

People often believe that it is unethical to present impressions of themselves different from how they really are and generally doubt that they would successfully be able to sustain a public image inconsistent with their actual characteristics (Leary, 2001).

This risk of failure in portraying a deceptive image and the accompanying social sanctions deter people from presenting impressions discrepant from how they see themselves (Gergen, 1968; Jones and Pittman, 1982; Schlenker, 1980).

People can differ in how congruent their self-presentations are with their self-perceptions.

People who are high in public self-consciousness have less congruency between their private and public selves than those lower in public self-consciousness (Tunnell, 1984; Leary and Kowalski, 1990).

Desired identity

People’s desired and undesired selves – how they wish to be and not be on an internal level – also influence the images that they try to project.

Schlenker (1985) defines a desirable identity image as what a person “would like to be and thinks he or she really can be, at least at his or her best.”

People have a tendency to manage their impressions so that their images coincide with their desired selves and stay away from images that coincide with their undesired selves (Ogilivie, 1987; Schlenker, 1985; Leary, 2001).

This happens when people publicly claim attributes consistent with their desired identity and openly reject identities that they do not want to be associated with.

For example, someone who abhors bigots may take every step possible to not appear bigoted, and Gergen and Taylor (1969) showed that high-status navel cadets did not conform to low-status navel cadets because they did not want to see themselves as conformists (Leary and Kowalski, 1990).

Target value

people tailor their self-presentations to the values of the individuals whose perceptions they are concerned with.

This may lead to people sometimes fabricating identities that they think others will value.

However, more commonly, people selectively present truthful aspects of themselves that they believe coincide with the values of the person they are targeting the impression to and withhold information that they think others will value negatively (Leary, 2001).

Role constraints

the content of people’s self-presentations is affected by the roles that they take on and the norms of their social context.

In general, people want to convey impressions consistent with their roles and norms .

Many roles even carry self-presentational requirements around the kinds of impressions that the people who hold the roles should and should not convey (Leary, 2001).

Current or potential social image

People’s public image choices are also influenced by how they think they are perceived by others. As in impression motivation, self-presentational behaviors can often be aimed at dispelling undesired impressions that others hold about an individual.

When people believe that others have or are likely to develop an undesirable impression of them, they will typically try to refute that negative impression by showing that they are different from how others believe them to be.

When they are not able to refute this negative impression, they may project desirable impressions in other aspects of their identity (Leary, 2001).

Implications

In the presence of others, few of the behaviors that people make are unaffected by their desire to maintain certain impressions. Even when not explicitly trying to create a particular impression of themselves, people are constrained by concerns about their public image.

Generally, this manifests with people trying not to create undesired impressions in virtually all areas of social life (Leary, 2001).

Tedeschi et al. (1971) argued that phenomena that psychologists previously attributed to peoples’ need to have cognitive consistency actually reflected efforts to maintain an impression of consistency in others’ eyes.

Studies have supported Tedeschi and their colleagues’ suggestion that phenomena previously attributed to cognitive dissonance were actually affected by self-presentational processes (Schlenker, 1980).

Psychologists have applied self-presentation to their study of phenomena as far-ranging as conformity, aggression, prosocial behavior, leadership, negotiation, social influence, gender, stigmatization, and close relationships (Baumeister, 1982; Leary, 1995; Schlenker, 1980; Tedeschi, 1981).

Each of these studies shows that people’s efforts to make impressions on others affect these phenomena, and, ultimately, that concerns self-presentation in private social life.

For example, research shows that people are more likely to be pro-socially helpful when their helpfulness is publicized and behave more prosocially when they desire to repair a damaged social image by being helpful (Leary, 2001).

In a similar vein, many instances of aggressive behavior can be explained as self-presentational efforts to show that someone is willing to hurt others in order to get their way.

This can go as far as gender roles, for which evidence shows that men and women behave differently due to the kind of impressions that are socially expected of men and women.

Baumeister, R. F. (1982). A self-presentational view of social phenomena. Psychological Bulletin, 91, 3-26.

Braginsky, B. M., Braginsky, D. D., & Ring, K. (1969). Methods of madness: The mental hospital as a last resort. New York: Holt, Rinehart & Winston.

Buss, A. H., & Briggs, S. (1984). Drama and the self in social interaction. Journal of Personality and Social Psychology, 47, 1310-1324. Gergen, K. J. (1968). Personal consistency and the presentation of self. In C. Gordon & K. J. Gergen (Eds.), The self in social interaction (Vol. 1, pp. 299-308). New York: Wiley.

Gergen, K. J., & Taylor, M. G. (1969). Social expectancy and self-presentation in a status hierarchy. Journal of Experimental Social Psychology, 5, 79-92.

Goffman, E. (1959). The moral career of the mental patient. Psychiatry, 22(2), 123-142.

• Goffman, E. (1963). Embarrassment and social organization.

Goffman, E. (1978). The presentation of self in everyday life (Vol. 21). London: Harmondsworth.

Goffman, E. (2002). The presentation of self in everyday life. 1959. Garden City, NY, 259.

Martey, R. M., & Consalvo, M. (2011). Performing the looking-glass self: Avatar appearance and group identity in Second Life. Popular Communication, 9 (3), 165-180.

Jones E E (1964) Ingratiation. Appleton-Century-Crofts, New York.

Jones, E. E., & Pittman, T. S. (1982). Toward a general theory of strategic self-presentation. Psychological perspectives on the self, 1(1), 231-262.

Leary M R (1995) Self-presentation: Impression Management and Interpersonal Behaior. Westview Press, Boulder, CO.

Leary, M. R.. Impression Management, Psychology of, in Smelser, N. J., & Baltes, P. B. (Eds.). (2001). International encyclopedia of the social & behavioral sciences (Vol. 11). Amsterdam: Elsevier.

Leary, M. R., & Kowalski, R. M. (1990). Impression management: A literature review and two-component model. Psychological bulletin, 107(1), 34.

Leary M R, Tchvidjian L R, Kraxberger B E 1994 Self-presentation may be hazardous to your health. Health Psychology 13: 461–70.

Ogilvie, D. M. (1987). The undesired self: A neglected variable in personality research. Journal of Personality and Social Psychology, 52, 379-385.

• Schlenker, B. R. (1980). Impression management (Vol. 222). Monterey, CA: Brooks/Cole.

Schlenker, B. R. (1985). Identity and self-identification. In B. R. Schlenker (Ed.), The self and social life (pp. 65-99). New York: McGraw-Hill.

Schlenker, B. R., & Leary, M. R. (1982). Social anxiety and self-presentation: A conceptualization model. Psychological bulletin, 92(3), 641.

Tedeschi, J. T, Smith, R. B., Ill, & Brown, R. C., Jr. (1974). A reinterpretation of research on aggression. Psychological Bulletin, 81, 540- 563.

Tseëlon, E. (1992). Is the presented self sincere? Goffman, impression management and the postmodern self. Theory, culture & society, 9(2), 115-128.

Tunnell, G. (1984). The discrepancy between private and public selves: Public self-consciousness and its correlates. Journal of Personality Assessment, 48, 549-555.

Further Information

• Solomon, J. F., Solomon, A., Joseph, N. L., & Norton, S. D. (2013). Impression management, myth creation and fabrication in private social and environmental reporting: Insights from Erving Goffman. Accounting, organizations and society, 38(3), 195-213.
• Gardner, W. L., & Martinko, M. J. (1988). Impression management in organizations. Journal of management, 14(2), 321-338.
• Scheff, T. J. (2005). Looking‐Glass self: Goffman as symbolic interactionist. Symbolic interaction, 28(2), 147-166.

• Skip to main content
• Skip to primary sidebar

IResearchNet

Self-Presentation

Self-presentation definition.

Self-presentation refers to how people attempt to present themselves to control or shape how others (called the audience) view them. It involves expressing oneself and behaving in ways that create a desired impression. Self-presentation is part of a broader set of behaviors called impression management. Impression management refers to the controlled presentation of information about all sorts of things, including information about other people or events. Self-presentation refers specifically to information about the self.

Self-Presentation History and Modern Usage

Early work on impression management focused on its manipulative, inauthentic uses that might typify a used car salesperson who lies to sell a car, or someone at a job interview who embellishes accomplishments to get a job. However, researchers now think of self-presentation more broadly as a pervasive aspect of life. Although some aspects of self-presentation are deliberate and effortful (and at times deceitful), other aspects are automatic and done with little or no conscious thought. For example, a woman may interact with many people during the day and may make different impressions on each person. When she starts her day at her apartment, she chats with her roommates and cleans up after breakfast, thereby presenting the image of being a good friend and responsible roommate. During classes, she responds to her professor’s questions and carefully takes notes, presenting the image of being a good student. Later that day, she calls her parents and tells them about her classes and other activities (although likely leaving out information about some activities), presenting the image of being a loving and responsible daughter. That night, she might go to a party or dancing with friends, presenting the image of being fun and easygoing. Although some aspects of these self-presentations may be deliberate and conscious, other aspects are not. For example, chatting with her roommates and cleaning up after breakfast may be habitual behaviors that are done with little conscious thought. Likewise, she may automatically hold the door open for an acquaintance or buy a cup of coffee for a friend. These behaviors, although perhaps not done consciously or with self-presentation in mind, nevertheless convey an image of the self to others.

Although people have the ability to present images that are false, self-presentations are often genuine; they reflect an attempt by the person to have others perceive him or her accurately, or at least consistent with how the person perceives himself or herself. Self-presentations can vary as a function of the audience; people present different aspects of themselves to different audiences or under different conditions. A man likely presents different aspects of himself to his close friends than he does to his elderly grandmother, and a woman may present a different image to her spouse than she does to her employer. This is not to say that these different images are false. Rather, they represent different aspects of the self. The self is much like a gem with multiple facets. The gem likely appears differently depending on the angle at which it is viewed. However, the various appearances are all genuine. Even if people present a self-image that they know to be false, they may begin to internalize the self-image and thereby eventually come to believe the self-pres

entation. For example, a man may initially present an image of being a good student without believing it to be genuine, but after attending all his classes for several weeks, visiting the professor during office hours, and asking questions during class, he may come to see himself as truly being a good student. This internalization process is most likely to occur when people make a public commitment to the self-image, when the behavior is at least somewhat consistent with their self-image, and when they receive positive feedback or other rewards for presenting the self-image.

Self-presentation is often directed to external audiences such as friends, lovers, employers, teachers, children, and even strangers. Self-presentation is more likely to be conscious when the presenter depends on the audience for some reward, expects to interact with the audience in the future, wants something from the audience, or values the audience’s approval. Yet self-presentation extends beyond audiences that are physically present to imagined audiences, and these imagined audiences can have distinct effects on behavior. A young man at a party might suddenly think about his parents and change his behavior from rambunctious to reserved. People sometimes even make self-presentations only for themselves. For instance, people want to claim certain identities, such as being fun, intelligent, kind, moral, and they may behave in line with these identities even in private.

Self-Presentation Goals

Self-presentation is inherently goal-directed; people present certain images because they benefit from the images in some way. The most obvious benefits are interpersonal, arising from getting others to do what one wants. A job candidate may convey an image of being hardworking and dependable to get a job; a salesperson may convey an image of being trustworthy and honest to achieve a sale. People may also benefit from their self-presentations by gaining respect, power, liking, or other desirable social rewards. Finally, people make certain impressions on others to maintain a sense of who they are, or their self-concept. For example, a man who wants to think of himself as a voracious reader might join a book club or volunteer at a library, or a woman who wishes to perceive herself as generous may contribute lavishly to a charitable cause. Even when there are few or no obvious benefits of a particular self-presentation, people may simply present an image that is consistent with the way they like to think about themselves, or at least the way they are accustomed to thinking about themselves.

Much of self-presentation is directed toward achieving one of two desirable images. First, people want to appear likeable. People like others who are attractive, interesting, and fun to be with. Thus, a sizable proportion of self-presentation revolves around developing, maintaining, and enhancing appearance and conveying and emphasizing characteristics that others desire, admire, and enjoy. Second, people want to appear competent. People like others who are skilled and able, and thus another sizable proportion of self-presentation revolves around conveying an image of competence. Yet, self-presentation is not so much about presenting desirable images as it is about presenting desired images, and some desired images are not necessarily desirable. For example, schoolyard bullies may present an image of being dangerous or intimidating to gain or maintain power over others. Some people present themselves as weak or infirmed (or exaggerate their weaknesses) to gain help from others. For instance, a member of a group project may display incompetence in the hope that other members will do more of the work, or a child may exaggerate illness to avoid going to school.

Self-Presentation Avenues

People self-present in a variety of ways. Perhaps most obviously, people self-present in what they say. These verbalizations can be direct claims of a particular image, such as when a person claims to be altruistic. They also can be indirect, such as when a person discloses personal behaviors or standards (e.g., “I volunteer at a hospital”). Other verbal presentations emerge when people express attitudes or beliefs. Divulging that one enjoys backpacking through Europe conveys the image that one is a world-traveler. Second, people self-present nonverbally in their physical appearance, body language, and other behavior. Smiling, eye contact, and nods of agreement can convey a wealth of information. Third, people self-present through the props they surround themselves with and through their associations. Driving an expensive car or flying first class conveys an image of having wealth, whereas an array of diplomas and certificates on one’s office walls conveys an image of education and expertise. Likewise, people judge others based on their associations. For example, being in the company of politicians or movie stars conveys an image of importance, and not surprisingly, many people display photographs of themselves with famous people. In a similar vein, high school students concerned with their status are often careful about which classmates they are seen and not seen with publicly. Being seen by others in the company of someone from a member of a disreputable group can raise questions about one’s own social standing.

Self-Presentation Pitfalls

Self-presentation is most successful when the image presented is consistent with what the audience thinks or knows to be true. The more the image presented differs from the image believed or anticipated by the audience, the less willing the audience will be to accept the image. For example, the lower a student’s grade is on the first exam, the more difficulty he or she will have in convincing a professor that he or she will earn an A on the next exam. Self-presentations are constrained by audience knowledge. The more the audience knows about a person, the less freedom the person has in claiming a particular identity. An audience that knows very little about a person will be more accepting of whatever identity the person conveys, whereas an audience that knows a great deal about a person will be less accepting.

People engaging in self-presentation sometimes encounter difficulties that undermine their ability to convey a desired image. First, people occasionally encounter the multiple audience problem, in which they must simultaneously present two conflicting images. For example, a student while walking with friends who know only her rebellious, impetuous side may run into her professor who knows only her serious, conscientious side. The student faces the dilemma of conveying the conflicting images of rebellious friend and serious student. When both audiences are present, the student must try to behave in a way that is consistent with how her friends view her, but also in a way that is consistent with how her professor views her. Second, people occasionally encounter challenges to their self-presentations. The audience may not believe the image the person presents. Challenges are most likely to arise when people are managing impressions through self-descriptions and the self-descriptions are inconsistent with other evidence. For example, a man who claims to be good driver faces a self-presentational dilemma if he is ticketed or gets in an automobile accident. Third, self-presentations can fail when people lack the cognitive resources to present effectively because, for example, they are tired, anxious, or distracted. For instance, a woman may yawn uncontrollably or reflexively check her watch while talking to a boring classmate, unintentionally conveying an image of disinterest.

Some of the most important images for people to convey are also the hardest. As noted earlier, among the most important images people want to communicate are likeability and competence. Perhaps because these images are so important and are often rewarded, audiences may be skeptical of accepting direct claims of likeability and competence from presenters, thinking that the person is seeking personal gain. Thus, people must resort to indirect routes to create these images, and the indirect routes can be misinterpreted. For example, the student who sits in the front row of the class and asks a lot of questions may be trying to project an image of being a competent student but may be perceived negatively as a teacher’s pet by fellow students.

Finally, there is a dark side to self-presentation. In some instances, the priority people place on their appearances or images can threaten their health. People who excessively tan are putting a higher priority on their appearance (e.g., being tan) than on their health (e.g., taking precautions to avoid skin cancer). Similarly, although condoms help protect against sexually transmitted diseases and unwanted pregnancy, self-presentational concerns may dissuade partners or potential partners from discussing, carrying, or using condoms. Women may fear that carrying condoms makes them seem promiscuous or easy, whereas men may fear that carrying condoms makes them seem presumptuous, as if they are expecting to have sex. Self-presentational concerns may also influence interactions with health care providers and may lead people to delay or avoid embarrassing medical tests and procedures or treatments for conditions that are embarrassing. For example, people may be reluctant to seek tests or treatment for sexually transmitted diseases, loss of bladder control, mental disorders, mental decline, or other conditions associated with weakness or incompetence. Finally, concerns with social acceptance may prompt young people to engage in risky behaviors such as excessive alcohol consumption, sexual promiscuity, or juvenile delinquency.

References:

• Jones, E. E., Pittman, T. S. (1982). Toward a general theory of strategic self-presentation. In J. Suls (Ed.), Psychological perspectives on the self (Vol. 1, pp. 231-260). Hillsdale, NJ: Erlbaum.
• Leary, M. R. (1996). Self-presentation: Impression management and interpersonal behavior. Boulder, CO: Westview Press.
• Leary, M. R., Tchividjian, L. R., & Kraxberger, B. E. (1994). Self-presentation can be hazardous to your health: Impression management and health risk. Health Psychology, 13, 461-470.
• Schlenker, B. R. (1980). Impression management: The self-concept, social identity, and interpersonal relations. Monterey, CA: Brooks/Cole.

Self-Presentation Theory

Self-Presentation Theory: Understanding the Art of Impression Management

In the grand theater of life, where every social interaction is a stage and we are both the actors and the audience, self-presentation theory takes center stage. It whispers the secrets of our performances, the subtle art of crafting personas, and the intricate dance between authenticity and impression. As we pull back the curtain on this psychological narrative, we delve into the depths of human behavior, exploring how the masks we wear and the roles we play are not merely acts of deception but profound expressions of our deepest desires to connect, belong, and be understood in the ever-unfolding drama of existence.

Self-presentation theory, originating from the field of social psychology, delves into the intricate ways individuals strategically convey and portray their desired image to others. This theory explores the underlying motivations and cognitive processes governing how people present themselves in social situations, aiming to understand the dynamics of impression management.

Key Definition:

Self-presentation theory refers to the behavior and strategies individuals use to shape the perceptions that others form about them. This theory suggests that individuals strive to convey a favorable impression to others by managing their public image. It encompasses various aspects such as impression management, identity, and social interaction, and is often associated with social psychology and communication studies. According to this theory, individuals may engage in behaviors such as self-disclosure, performance, and conformity to influence how others perceive them.

Origins and Development

The concept of self-presentation theory was initially formulated by sociologist Erving Goffman, in his seminal work The Presentation of Self in Everyday Life , originally published in 1956. Goffman’s was first to create a specific theory concerning self-presentation, laying the foundation for what is now commonly referred to as impression management. His book became widely known after its publication in the United States in 1959.

Goffman’s theory draws from the imagery of theater to portray the importance of human social interaction. He proposed that in social interactions, individuals perform much like actors on a stage, managing the impressions others form of them by controlling information in various ways. This process involves a “front” where the individual presents themselves in a certain manner, and a “back” where they can step out of their role.

His work has been influential in sociology, social psychology, and anthropology, as it was the first to treat face-to-face interaction as a subject of sociological study. Goffman’s dramaturgical analysis observes a connection between the kinds of acts people put on in their daily life and theatrical performances. The theory has had a lasting impact on our understanding of social behavior and continues to be a significant reference point in studies of social interaction.

Impression Management Strategies

Much of Goffman’s early work suggests that “avoidance of shame is an important, indeed a crucial, motive in virtually all social behavior.” Goffman posits that impression management is typically a greater motivation than rational and instrumental goals. Thomas J. Scheff explains that “one tries to control the impression one makes on others, even others who are not significant to one’s life” ( Scheff, 1997. Kindle location: 4,106 ).

Self-presentation theory encompasses a spectrum of strategies employed by individuals to shape others’ perceptions of them. Impression management strategies in social interaction theory are the various techniques individuals use to influence how others perceive them. Individuals employ these strategies to present themselves in a favorable light. The motivation is to achieve specific goals or maintain certain relationships. Here are some key impression management strategies:

• Self-Promotion : Highlighting one’s own positive qualities, achievements, and skills to be seen as competent and capable.
• Ingratiation : Using flattery or praise to make oneself likable to others, often to gain their favor or approval.
• Exemplification : Demonstrating one’s own moral integrity or dedication to elicit respect and admiration from others.
• Intimidation : Projecting a sense of power or threat to influence others to comply with one’s wishes.
• Supplication : Presenting oneself as weak or needy to elicit sympathy or assistance from others.

These strategies can be assertive, involving active attempts to shape one’s image, or defensive, aimed at protecting one’s image. The choice of strategy depends on the individual’s goals, the context of the interaction, and the nature of the relationship.

The Game of Presentation

In many ways, self-presentation opposes other psychology concepts such as authenticity. We adapt to ur environments, and present ourselves accordingly. We act much different at grandma’s house than we do when out drinking with our friends. Perhaps, authenticity is context dependent. However, we can present ourselves differently in different situations without violating core self-values. The presentations may differ but the self remains unchanged.

Carl Jung mused in reflection of his childhood interactions with his friends that, “I found that they alienated me from myself. When I was with them I became different from the way I was at home.” He continues, “it seemed to me that the change in myself was due to the influence of my schoolfellows, who somehow misled me or compelled me to be different from what I thought I was” ( Jung, 2011 ).

Jonathan Haidt suggests that it is merely game. He wrote, “to win at this game you must present your best possible self to others. You must appear virtuous, whether or not you are, and you must gain the benefits of cooperation whether or not you deserve them.” He continues to warn “but everyone else is playing the same game, so you must also play defense—you must be wary of others’ self-presentations, and of their efforts to claim more for themselves than they deserve” ( Haidt, 2003. Kindle location: 1,361 ).

Healthy and Unhealthy Modes of Self-Presentation

We all self-present, creating images that fit the context. While seeking a partner, we self-present a person who is worthy of investing time in. Only in time, do some of these masks begin to fade. Impression management is essential to build new relationships, get the job, and prevent social rejection. Mahzarin R, Banaji and Anthony G. Greenwald wrote, “honesty may be an overrated virtue. If you decided to report all of your flaws to friends and to apply a similar standard of total honesty when talking to others about their shortcomings, you might soon find that you no longer have friends.” they continue, “our daily social lives demand, and generally receive, repeated lubrication with a certain amount of untruthfulness, which keeps the gears of social interaction meshing smoothly” ( Banaji & Greenwald, 2016, pp. 28-29 ).

However, this healthy practice morphs into something sinister when the presented self has nothing to do with the real self. Daniel Goleman refers to individuals that engage in unhealthy deceitful presentations as social chameleons. He wrote, “the social chameleon will seem to be whatever those he is with seem to want. The sign that someone falls into this pattern…is that they make an excellent impression, yet have few stable or satisfying intimate relationships” ( Golman, 2011. Kindle location: 2,519 ).

Goleman explains that “a more healthy pattern, of course, is to balance being true to oneself with social skills, using them with integrity.” He adds, “social chameleons, though, don’t mind in the least saying one thing and doing another, if that will win them social approval” ( Goleman, 2011. Kindle location: 2,523 ).

Situational Influences

The application of self-presentation strategies is contingent upon the social context and the specific goals an individual pursues. In professional settings, individuals may engage in self-promotion to advance their careers, while in personal relationships, they might prioritize authenticity and sincerity. The ubiquity of social media further complicates self-presentation, as individuals navigate the curation of online personas and the management of digital identities.

In the professional realm, the strategic presentation of oneself can play a crucial role in career development and success. This may involve showcasing one’s achievements, skills, and expertise to stand out in a competitive environment. However, it’s important to strike a balance between self-promotion and humility to maintain credibility and foster positive professional relationships.

On the other hand, personal relationships often thrive on genuine connections and authenticity. In these contexts, individuals may choose to present themselves in a sincere manner, emphasizing vulnerability and openness to establish meaningful connections with others. While occasional self-promotion may still occur, the emphasis is more on building trust and rapport.

Social Media and Self-Presentation

The rise of social media has introduced a new layer of complexity to self-presentation. Platforms like Facebook, Instagram, and LinkedIn offer opportunities for individuals to craft their virtual identities. This process involves selective sharing of information, curation of posts and images, and the management of online interactions. The challenge lies in maintaining a balance between projecting an aspirational image and staying true to one’s authentic self in the digital sphere.

In Goffman’s lengthy comparison between actors and audience suggests that anyone could perform, presenting a certain image. However, he points out that if the actor is a known criminal the audience would not be able to accept their performance, knowing it is a fraud. The actor may enjoy success by going on the road, performing to audiences that are not aware of the actor’s criminal past ( Goffman, 1956, p. 223 ). The internet allows the individual with a shady past to bring their show on the road to an unsuspecting audience who can buy their deceitful performance.

Navigating these diverse self-presentation strategies requires individuals to be mindful of the specific social contexts and their underlying goals. Whether it’s in the professional arena or personal relationships, the nuanced art of self-presentation continues to evolve in the digital age, shaping how individuals perceive and position themselves in the world.

Self-Presentation and Emotional Labor

The intersection of self-presentation theory with emotional labor is a topic of significant interest. Emotional labor pertains to the management of one’s emotions to meet the demands of a particular role or job. Individuals often engage in self-presentation to display appropriate emotions in various settings, leading to a convergence between impression management and emotional regulation. One of the key aspects of this intersection is the impact it has on employee well-being.

Research has shown that the need to regulate emotions in the workplace can lead to emotional exhaustion and burnout. Additionally, there are important implications for organizations, as they have a vested interest in understanding and managing the emotional labor of their employees. Effective programs may enhance employee well-being and improve the quality of service provided to customers. Moreover, the intersection of self-presentation and emotional labor can also be examined through the lens of gender and cultural differences. These examination may highlight the complexities and nuances of this phenomenon in diverse contexts. Understanding this intersection is crucial for creating supportive work environments and fostering healthy, sustainable emotional practices.

See Emotional Labor for more on this topic

Implications and Future Directions

Understanding self-presentation theory has widespread implications, spanning from interpersonal relationships to organizational dynamics. By acknowledging the nuanced strategies individuals employ to shape perceptions, psychologists and practitioners can better grasp human behavior in diverse contexts. Future research may delve into the interplay between self-presentation and cultural factors. In addition, further research may cast light on the psychological effects of sustained impression management on individuals’ well-being.

As individuals, we can understand that we, as well as others, use impression management. Before investing significant resources, we would be wise to try to unmask the presenter and make a decision based on reality rather than expertely presented deceptions.

A List of Practical Implications

Understanding the concepts related to self-presentation theory, such as impression management, self-concept, and social identity, has several practical implications in everyday life:

• Enhanced Social Interactions : By being aware of how we present ourselves, we can navigate social situations more effectively, tailoring our behavior to suit different contexts and relationships.
• Improved Professional Relationships : In the workplace, understanding self-presentation can help in managing professional personas, leading to better workplace dynamics and career advancement.
• Personal Development : Recognizing the strategies we use for impression management can lead to greater self-awareness and personal growth, as we align our external presentation with our internal values.
• Conflict Resolution : Awareness of self-presentation strategies can aid in resolving conflicts by understanding the motivations behind others’ behaviors and addressing the underlying issues.
• Mental Health : Understanding the effort involved in emotional labor and impression management can help in identifying when these efforts are leading to stress or burnout, prompting us to seek support or make changes.
• Authentic Relationships : By balancing self-presentation with authenticity, we can foster deeper and more genuine connections with others.
• Cultural Competence : Recognizing the role of social identity in self-presentation can enhance our sensitivity to cultural differences and improve cross-cultural communication.

Overall, these concepts can empower us to be more intentional in our interactions, leading to more fulfilling and effective communication in our personal and professional lives.

Associated Psychological Concepts to Self-Presentation Theory

Self-presentation theory is intricately connected to a variety of psychological concepts that help explain the behaviors and motivations behind how individuals present themselves to others. Here are some related concepts:

• Self-Concept : This refers to how people perceive themselves and their awareness of who they are. Self-presentation is often a reflection of one’s self-concept, as individuals attempt to project an image that aligns with their self-perception.
• Impression Management : This is the process by which individuals attempt to control the impressions others form of them. It involves a variety of strategies to influence others’ perceptions in a way that is favorable to the individual.
• Social Identity : The part of an individual’s self-concept derived from their membership in social groups. Self-presentation can be used to highlight certain aspects of one’s social identity.
• Cognitive Dissonance : This occurs when there is a discrepancy between one’s beliefs and behaviors. Self-presentation strategies may be employed to reduce cognitive dissonance by aligning one’s outward behavior with internal beliefs.
• Role Theory : Suggests that individuals behave in ways that align with the expectations of the social roles they occupy. Self-presentation can be seen as performing the appropriate role in a given context.
• Self-Es teem : The value one places on oneself. Self-presentation can be a means to enhance or protect one’s self-esteem by controlling how others view them.
• Self-Efficacy : One’s belief in their ability to succeed. Through self-presentation, individuals may seek to project confidence and competence to others, thereby reinforcing their own sense of self-efficacy.

These concepts are interrelated and contribute to the understanding of self-presentation theory as a whole, providing insight into the complex nature of social interactions and the motivations behind individuals’ efforts to influence how they are perceived by others.

A Few Words by Psychology Fanatic

In essence, self-presentation theory captures the multifaceted nature of human interaction, shedding light on the conscious and subconscious processes governing how individuals present themselves in the social arena. By unraveling the intricacies of impression management, researchers continue to unveil the complexities of human behavior and the underlying motivations that propel our interactions with others.

Last Update: April 29, 2024

Type your email…

References:

Goffman, Erving (1956/ 2021 ). The Presentation of Self in Everyday Life. Anchor

Goleman, Daniel ( 2005 ). Emotional Intelligence: Why It Can Matter More Than IQ. Bantam Books . Read on Kindle Books.

Haidt, Jonathan ( 2003 ). The Happiness Hypothesis: Finding Modern Truth in Ancient Wisdom. Basic Books ; 1st edition.

Jung, Carl Gustav (1961/ 2011 ). Memories, Dreams, Reflections. Vintage ; Reissue edition.

Banaji, Mahzarin R.; Greenwald, Anthony G. ( 2016 ). Blindspot: Hidden Biases of Good People.  Bantam ; Reprint edition.

Scheff, Thomas J. ( 1997 ). Shame in Social Theory. Editors Lansky, M. R. and Morrison, A. P. In The Widening Scope of Shame. ​ Routledge ; 1st edition.

Resources and Articles

Please visit Psychology Fanatic’s vast selection of articles , definitions and database of referenced books .

* Many of the quotes from books come books I have read cover to cover. I created an extensive library of notes from these books. I make reference to these books when using them to support or add to an article topic. Most of these books I read on a kindle reader. The Kindle location references seen through Psychology Fanatic is how kindle notes saves my highlights.

The peer reviewed article references mostly come from Deepdyve . This is the periodical database that I have subscribe to for nearly a decade. Over the last couple of years, I have added a DOI reference to cited articles for the reader’s convenience and reference.

Thank-you for visiting Psychology Fanatic. Psychology Fanatic represents nearly two decades of work, research, and passion.

Topic Specific Databases:

PSYCHOLOGY – EMOTIONS – RELATIONSHIPS – WELLNESS – PSYCHOLOGY TOPICS

Share this:

About the author.

T. Franklin Murphy

Related posts.

Group Dynamics

Group dynamics examine collective behavior, interactions, and processes within groups, shedding light on social influence, cohesion, and decision-making. Its rich history, diverse theories, and applications…

Read More »

Interdependence Theory

Interdependence Theory, a cornerstone of social psychology, explores the interconnected nature of relationships and the mutual influence among individuals. It offers insights into different types…

Nurturing Love

When the bonds of nurturing love are strong, both partners gracefully contribute to the well-being of the other.

Robbers Cave Experiment

The Robbers Cave Experiment, led by Muzafer Sherif, revealed the dark side of intergroup conflict. It demonstrated the power of group dynamics, realistic conflict theory,…

Emotions and Empathy

Emotions and empathy work together. Shared feelings bring new aliveness. However, for some, empathy and feelings are frightening.

Emotional Intimacy

Emotional intimacy is essential for deep connections, involving trust, vulnerability, and open communication. It fosters understanding and empathy, but also carries the risk of rejection…

Leave a Reply Cancel reply

Discover more from psychology fanatic.

Subscribe now to keep reading and get access to the full archive.

Continue reading

Last updated 09/07/24: Online ordering is currently unavailable due to technical issues. We apologise for any delays responding to customers while we resolve this. For further updates please visit our website: https://www.cambridge.org/news-and-insights/technical-incident

We use cookies to distinguish you from other users and to provide you with a better experience on our websites. Close this message to accept cookies or find out how to manage your cookie settings .

Login Alert

• > Social Signal Processing
• > Self-presentation: Signaling Personal and Social Characteristics

Book contents

• Frontmatter
• Contributors
• 1 Introduction: Social Signal Processing
• Part I Conceptual Models of Social Signals
• 2 Biological and Social Signaling Systems
• 3 Universal Dimensions of Social Signals: Warmth and Competence
• 4 The Vertical Dimension of Social Signaling
• 5 Measuring Responses to Nonverbal Social Signals: Research on Affect Receiving Ability
• 6 Computational Analysis of Vocal Expression of Affect: Trends and Challenges
• 7 Self-presentation: Signaling Personal and Social Characteristics
• 8 Interaction Coordination and Adaptation
• 9 Social Signals and Persuasion
• 10 Social Presence in CMC and VR
• Part II Machine Analysis of Social Signals
• Part III Machine Synthesis of Social Signals
• Part IV Applications of Social Signal Processing

7 - Self-presentation: Signaling Personal and Social Characteristics

from Part I - Conceptual Models of Social Signals

Published online by Cambridge University Press:  13 July 2017

When people interact, their behaviors are greatly influenced by the impressions they have of one another's personalities, abilities, attitudes, intentions, identities, roles, and other characteristics. In fact, many important outcomes in life – outcomes as diverse as friendships, professional success, income, romantic relationships, influence over others, and social support – depend to a significant extent on the impressions that people make on others. Knowing that others respond to them on the basis of their public impressions, people devote considerable thought and energy to conveying impressions that will lead others to treat them in desired ways. In many instances, the impressions people project of themselves are reasonably accurate attempts to let other people know who they are and what they are like (Murphy, 2007). At other times, people may convey impressions of themselves that they know are not entirely accurate, if not blatantly deceptive, when they believe that fostering such images will result in desired outcomes (Hancock & Toma, 2009).

Social and behavioral scientists refer to people's efforts to manage their public images as self-presentation or impression management (Goffman, 1959; Schlenker, 2012). Some researchers use different terms for the process of controlling one's public image depending on whether the efforts are honest or deceitful and whether they involve impressions of one's personal characteristics or information about one's social roles and identity. But we will use the terms interchangeably to refer to any intentional effort to convey a particular impression of oneself to another person without respect to the accuracy or content of the effort.

Tactics of Self-presentation

Nearly every aspect of people's behavior provides information from which others can draw inferences about them, but actions are considered self-presentational only if they are enacted, at least in part, with the goal of leading other people to perceive the individual in a particular way. People convey information about their personal and social characteristics using a wide array of tactics.

Verbal Claims

The most direct self-presentational tactics involve verbal statements that make a particular claim regarding one's personal or social characteristics.

Access options

Save book to kindle.

To save this book to your Kindle, first ensure [email protected] is added to your Approved Personal Document E-mail List under your Personal Document Settings on the Manage Your Content and Devices page of your Amazon account. Then enter the ‘name’ part of your Kindle email address below. Find out more about saving to your Kindle .

Note you can select to save to either the @free.kindle.com or @kindle.com variations. ‘@free.kindle.com’ emails are free but can only be saved to your device when it is connected to wi-fi. ‘@kindle.com’ emails can be delivered even when you are not connected to wi-fi, but note that service fees apply.

Find out more about the Kindle Personal Document Service .

• Self-presentation: Signaling Personal and Social Characteristics
• By Mark R. Leary , Duke University, Katrina P. Jongman-Sereno , Duke University
• Edited by Judee K. Burgoon , University of Arizona , Nadia Magnenat-Thalmann , Université de Genève , Maja Pantic , Imperial College London , Alessandro Vinciarelli , University of Glasgow
• Book: Social Signal Processing
• Online publication: 13 July 2017
• Chapter DOI: https://doi.org/10.1017/9781316676202.007

Save book to Dropbox

To save content items to your account, please confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your account. Find out more about saving content to Dropbox .

Save book to Google Drive

To save content items to your account, please confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your account. Find out more about saving content to Google Drive .

Want to create or adapt books like this? Learn more about how Pressbooks supports open publishing practices.

68 Self-Presentation, Attitudes, and Persuasion

Learning outcomes.

By the end of this section, you will be able to:

• Describe social roles and how they influence behavior
• Explain what social norms are and how they influence behavior
• Define script
• Describe the findings of Zimbardo’s Stanford prison experiment
• Define attitude
• Describe how people’s attitudes are internally changed through cognitive dissonance
• Explain how people’s attitudes are externally changed through persuasion
• Describe the peripheral and central routes to persuasion

Self-presentation

As you’ve learned, social psychology is the study of how people affect one another’s thoughts, feelings, and behaviors. We have discussed situational perspectives and social psychology’s emphasis on the ways in which a person’s environment, including culture and other social influences, affect behavior. In this section, we examine situational forces that have a strong influence on human behavior including social roles, social norms, and scripts. We discuss how humans use the social environment as a source of information, or cues, on how to behave. Situational influences on our behavior have important consequences, such as whether we will help a stranger in an emergency or how we would behave in an unfamiliar environment.

SOCIAL ROLES

One major social determinant of human behavior is our social roles. A  social role  is a pattern of behavior that is expected of a person in a given setting or group (Hare, 2003). Each one of us has several social roles. You may be, at the same time, a student, a parent, an aspiring teacher, a son or daughter, a spouse, and a lifeguard. How do these social roles influence your behavior? Social roles are defined by culturally shared knowledge. That is, nearly everyone in a given culture knows what behavior is expected of a person in a given role. For example, what is the social role for a student? If you look around a college classroom you will likely see students engaging in studious behavior, taking notes, listening to the professor, reading the textbook, and sitting quietly at their desks ( Figure ). Of course you may see students deviating from the expected studious behavior such as texting on their phones or using Facebook on their laptops, but in all cases, the students that you observe are attending class—a part of the social role of students.

Social roles, and our related behavior, can vary across different settings. How do you behave when you are engaging in the role of son or daughter and attending a family function? Now imagine how you behave when you are engaged in the role of employee at your workplace. It is very likely that your behavior will be different. Perhaps you are more relaxed and outgoing with your family, making jokes and doing silly things. But at your workplace you might speak more professionally, and although you may be friendly, you are also serious and focused on getting the work completed. These are examples of how our social roles influence and often dictate our behavior to the extent that identity and personality can vary with context (that is, in different social groups) (Malloy, Albright, Kenny, Agatstein & Winquist, 1997).

SOCIAL NORMS

As discussed previously, social roles are defined by a culture’s shared knowledge of what is expected behavior of an individual in a specific role. This shared knowledge comes from social norms. A  social norm  is a group’s expectation of what is appropriate and acceptable behavior for its members—how they are supposed to behave and think (Deutsch & Gerard, 1955; Berkowitz, 2004). How are we expected to act? What are we expected to talk about? What are we expected to wear? In our discussion of social roles we noted that colleges have social norms for students’ behavior in the role of student and workplaces have social norms for employees’ behaviors in the role of employee. Social norms are everywhere including in families, gangs, and on social media outlets. What are some social norms on Facebook?

My 11-year-old daughter, Jessica, recently told me she needed shorts and shirts for the summer, and that she wanted me to take her to a store at the mall that is popular with preteens and teens to buy them. I have noticed that many girls have clothes from that store, so I tried teasing her. I said, “All the shirts say ‘Aero’ on the front. If you are wearing a shirt like that and you have a substitute teacher, and the other girls are all wearing that type of shirt, won’t the substitute teacher think you are all named ‘Aero’?”

My daughter replied, in typical 11-year-old fashion, “Mom, you are not funny. Can we please go shopping?”

I tried a different tactic. I asked Jessica if having clothing from that particular store will make her popular. She replied, “No, it will not make me popular. It is what the popular kids wear. It will make me feel happier.” How can a label or name brand make someone feel happier? Think back to what you’ve learned about  lifespan development . What is it about pre-teens and young teens that make them want to fit in ( Figure )? Does this change over time? Think back to your high school experience, or look around your college campus. What is the main name brand clothing you see? What messages do we get from the media about how to fit in?

Because of social roles, people tend to know what behavior is expected of them in specific, familiar settings. A  script  is a person’s knowledge about the sequence of events expected in a specific setting (Schank & Abelson, 1977). How do you act on the first day of school, when you walk into an elevator, or are at a restaurant? For example, at a restaurant in the United States, if we want the server’s attention, we try to make eye contact. In Brazil, you would make the sound “psst” to get the server’s attention. You can see the cultural differences in scripts. To an American, saying “psst” to a server might seem rude, yet to a Brazilian, trying to make eye contact might not seem an effective strategy. Scripts are important sources of information to guide behavior in given situations. Can you imagine being in an unfamiliar situation and not having a script for how to behave? This could be uncomfortable and confusing. How could you find out about social norms in an unfamiliar culture?

ZIMBARDO’S STANFORD PRISON EXPERIMENT

The famous  Stanford prison experiment , conducted by social psychologist Philip  Zimbardo  and his colleagues at Stanford University, demonstrated the power of social roles, social norms, and scripts. In the summer of 1971, an advertisement was placed in a California newspaper asking for male volunteers to participate in a study about the psychological effects of prison life. More than 70 men volunteered, and these volunteers then underwent psychological testing to eliminate candidates who had underlying psychiatric issues, medical issues, or a history of crime or drug abuse. The pool of volunteers was whittled down to 24 healthy male college students. Each student was paid $15 per day and was randomly assigned to play the role of either a prisoner or a guard in the study. Based on what you have learned about research methods, why is it important that participants were randomly assigned?

A mock prison was constructed in the basement of the psychology building at Stanford. Participants assigned to play the role of prisoners were “arrested” at their homes by Palo Alto police officers, booked at a police station, and subsequently taken to the mock prison. The experiment was scheduled to run for several weeks. To the surprise of the researchers, both the “prisoners” and “guards” assumed their roles with zeal. In fact, on day 2, some of the prisoners revolted, and the guards quelled the rebellion by threatening the prisoners with night sticks. In a relatively short time, the guards came to harass the prisoners in an increasingly sadistic manner, through a complete lack of privacy, lack of basic comforts such as mattresses to sleep on, and through degrading chores and late-night counts.

The prisoners, in turn, began to show signs of severe anxiety and hopelessness—they began tolerating the guards’ abuse. Even the Stanford professor who designed the study and was the head researcher, Philip Zimbardo, found himself acting as if the prison was real and his role, as prison supervisor, was real as well. After only six days, the experiment had to be ended due to the participants’ deteriorating behavior. Zimbardo explained,

At this point it became clear that we had to end the study. We had created an overwhelmingly powerful situation—a situation in which prisoners were withdrawing and behaving in pathological ways, and in which some of the guards were behaving sadistically. Even the “good” guards felt helpless to intervene, and none of the guards quit while the study was in progress. Indeed, it should be noted that no guard ever came late for his shift, called in sick, left early, or demanded extra pay for overtime work. (Zimbardo, 2013)

The Stanford prison experiment demonstrated the power of social roles, norms, and scripts in affecting human behavior. The guards and prisoners enacted their social roles by engaging in behaviors appropriate to the roles: The guards gave orders and the prisoners followed orders. Social norms require guards to be authoritarian and prisoners to be submissive. When prisoners rebelled, they violated these social norms, which led to upheaval. The specific acts engaged by the guards and the prisoners derived from scripts. For example, guards degraded the prisoners by forcing them do push-ups and by removing all privacy. Prisoners rebelled by throwing pillows and trashing their cells. Some prisoners became so immersed in their roles that they exhibited symptoms of mental breakdown; however, according to Zimbardo, none of the participants suffered long term harm (Alexander, 2001).

The Stanford Prison Experiment has some parallels with the abuse of prisoners of war by U.S. Army troops and CIA personnel at the Abu Ghraib prison in 2003 and 2004. The offenses at Abu  Ghraib  were documented by photographs of the abuse, some taken by the abusers themselves ( Figure ).

Visit this  website  to hear an NPR interview with Philip  Zimbardo  where he discusses the parallels between the Stanford prison experiment and the Abu Ghraib prison in Iraq.

Human behavior is largely influenced by our social roles, norms, and scripts. In order to know how to act in a given situation, we have shared cultural knowledge of how to behave depending on our role in society. Social norms dictate the behavior that is appropriate or inappropriate for each role. Each social role has scripts that help humans learn the sequence of appropriate behaviors in a given setting. The famous Stanford prison experiment is an example of how the power of the situation can dictate the social roles, norms, and scripts we follow in a given situation, even if this behavior is contrary to our typical behavior.

Review Questions

A(n) ________ is a set of group expectations for appropriate thoughts and behaviors of its members.

• social role
• social norm
• attribution

On his first day of soccer practice, Jose suits up in a t-shirt, shorts, and cleats and runs out to the field to join his teammates. Jose’s behavior is reflective of ________.

• social influence
• good athletic behavior
• normative behavior

When it comes to buying clothes, teenagers often follow social norms; this is likely motivated by ________.

• following parents’ rules
• saving money
• looking good

In the Stanford prison experiment, even the lead researcher succumbed to his role as a prison supervisor. This is an example of the power of ________ influencing behavior.

• social norms
• social roles

Critical Thinking Questions

Why didn’t the “good” guards in the Stanford prison experiment object to other guards’ abusive behavior? Were the student prisoners simply weak people? Why didn’t they object to being abused?

Describe how social roles, social norms, and scripts were evident in the Stanford prison experiment. How can this experiment be applied to everyday life? Are there any more recent examples where people started fulfilling a role and became abusive?

Personal Application Questions

Try attending a religious service very different from your own and see how you feel and behave without knowing the appropriate script. Or, try attending an important, personal event that you have never attended before, such as a bar mitzvah (a coming-of-age ritual in Jewish culture), a quinceañera (in some Latin American cultures a party is given to a girl who is turning 15 years old), a wedding, a funeral, or a sporting event new to you, such as horse racing or bull riding. Observe and record your feelings and behaviors in this unfamiliar setting for which you lack the appropriate script. Do you silently observe the action, or do you ask another person for help interpreting the behaviors of people at the event? Describe in what ways your behavior would change if you were to attend a similar event in the future?

Name and describe at least three social roles you have adopted for yourself. Why did you adopt these roles? What are some roles that are expected of you, but that you try to resist?

Attitudes and Persuasion

Social psychologists have documented how the power of the situation can influence our behaviors. Now we turn to how the power of the situation can influence our attitudes and beliefs.  Attitude  is our evaluation of a person, an idea, or an object. We have attitudes for many things ranging from products that we might pick up in the supermarket to people around the world to political policies. Typically, attitudes are favorable or unfavorable: positive or negative (Eagly & Chaiken, 1993). And, they have three components: an affective component (feelings), a behavioral component (the effect of the attitude on behavior), and a cognitive component (belief and knowledge) (Rosenberg & Hovland, 1960).

For example, you may hold a positive attitude toward recycling. This attitude should result in positive feelings toward recycling (such as “It makes me feel good to recycle” or “I enjoy knowing that I make a small difference in reducing the amount of waste that ends up in landfills”). Certainly, this attitude should be reflected in our behavior: You actually recycle as often as you can. Finally, this attitude will be reflected in favorable thoughts (for example, “Recycling is good for the environment” or “Recycling is the responsible thing to do”).

Our attitudes and beliefs are not only influenced by external forces, but also by internal influences that we control. Like our behavior, our attitudes and thoughts are not always changed by situational pressures, but they can be consciously changed by our own free will. In this section we discuss the conditions under which we would want to change our own attitudes and beliefs.

WHAT IS COGNITIVE DISSONANCE?

Social psychologists have documented that feeling good about ourselves and maintaining positive self-esteem is a powerful motivator of human behavior (Tavris & Aronson, 2008). In the United States, members of the predominant culture typically think very highly of themselves and view themselves as good people who are above average on many desirable traits (Ehrlinger, Gilovich, & Ross, 2005). Often, our behavior, attitudes, and beliefs are affected when we experience a threat to our self-esteem or positive self-image. Psychologist Leon Festinger (1957) defined  cognitive dissonance  as psychological discomfort arising from holding two or more inconsistent attitudes, behaviors, or cognitions (thoughts, beliefs, or opinions). Festinger’s theory of cognitive dissonance states that when we experience a conflict in our behaviors, attitudes, or beliefs that runs counter to our positive self-perceptions, we experience psychological discomfort (dissonance). For example, if you believe smoking is bad for your health but you continue to smoke, you experience conflict between your belief and behavior ( Figure ).

Later research documented that only conflicting cognitions that threaten individuals’ positive self-image cause dissonance (Greenwald & Ronis, 1978). Additional research found that dissonance is not only psychologically uncomfortable but also can cause physiological arousal (Croyle & Cooper, 1983) and activate regions of the brain important in emotions and cognitive functioning (van Veen, Krug, Schooler, & Carter, 2009). When we experience cognitive dissonance, we are motivated to decrease it because it is psychologically, physically, and mentally uncomfortable. We can reduce  cognitive dissonance  by bringing our cognitions, attitudes, and behaviors in line—that is, making them harmonious. This can be done in different ways, such as:

• changing our discrepant behavior (e.g., stop smoking),
• changing our cognitions through rationalization or denial (e.g., telling ourselves that health risks can be reduced by smoking filtered cigarettes),
• adding a new cognition (e.g., “Smoking suppresses my appetite so I don’t become overweight, which is good for my health.”).

A classic example of cognitive dissonance is John, a 20-year-old who enlists in the military. During boot camp he is awakened at 5:00 a.m., is chronically sleep deprived, yelled at, covered in sand flea bites, physically bruised and battered, and mentally exhausted ( Figure ). It gets worse. Recruits that make it to week 11 of boot camp have to do 54 hours of continuous training.

Not surprisingly, John is miserable. No one likes to be miserable. In this type of situation, people can change their beliefs, their attitudes, or their behaviors. The last option, a change of behaviors, is not available to John. He has signed on to the military for four years, and he cannot legally leave.

If John keeps thinking about how miserable he is, it is going to be a very long four years. He will be in a constant state of cognitive dissonance. As an alternative to this misery, John can change his beliefs or attitudes. He can tell himself, “I am becoming stronger, healthier, and sharper. I am learning discipline and how to defend myself and my country. What I am doing is really important.” If this is his belief, he will realize that he is becoming stronger through his challenges. He then will feel better and not experience cognitive dissonance, which is an uncomfortable state.

The Effect of Initiation

The military example demonstrates the observation that a difficult  initiation  into a group influences us to like the group  more , due to the justification of effort. We do not want to have wasted time and effort to join a group that we eventually leave. A classic experiment by Aronson and Mills (1959) demonstrated this justification of effort effect. College students volunteered to join a campus group that would meet regularly to discuss the psychology of sex. Participants were randomly assigned to one of three conditions: no initiation, an easy initiation, and a difficult initiation into the group. After participating in the first discussion, which was deliberately made very boring, participants rated how much they liked the group. Participants who underwent a difficult initiation process to join the group rated the group more favorably than did participants with an easy initiation or no initiation ( Figure ).

Similar effects can be seen in a more recent study of how student effort affects course evaluations. Heckert, Latier, Ringwald-Burton, and Drazen (2006) surveyed 463 undergraduates enrolled in courses at a midwestern university about the amount of effort that their courses required of them. In addition, the students were also asked to evaluate various aspects of the course. Given what you’ve just read, it will come as no surprise that those courses that were associated with the highest level of effort were evaluated as being more valuable than those that did not. Furthermore, students indicated that they learned more in courses that required more effort, regardless of the grades that they received in those courses (Heckert et al., 2006).

Besides the classic military example and group initiation, can you think of other examples of  cognitive dissonance ? Here is one: Marco and Maria live in Fairfield County, Connecticut, which is one of the wealthiest areas in the United States and has a very high cost of living. Marco telecommutes from home and Maria does not work outside of the home. They rent a very small house for more than $3000 a month. Maria shops at consignment stores for clothes and economizes where she can. They complain that they never have any money and that they cannot buy anything new. When asked why they do not move to a less expensive location, since Marco telecommutes, they respond that Fairfield County is beautiful, they love the beaches, and they feel comfortable there. How does the theory of cognitive dissonance apply to Marco and Maria’s choices?

In the previous section we discussed that the motivation to reduce cognitive dissonance leads us to change our attitudes, behaviors, and/or cognitions to make them consonant.  Persuasion  is the process of changing our attitude toward something based on some kind of communication. Much of the persuasion we experience comes from outside forces. How do people convince others to change their attitudes, beliefs, and behaviors ( Figure )? What communications do you receive that attempt to persuade you to change your attitudes, beliefs, and behaviors?

A subfield of social psychology studies persuasion and social influence, providing us with a plethora of information on how humans can be persuaded by others.

Yale Attitude Change Approach

The topic of persuasion has been one of the most extensively researched areas in social psychology (Fiske et al., 2010). During the Second World War, Carl  Hovland  extensively researched persuasion for the U.S. Army. After the war, Hovland continued his exploration of persuasion at Yale University. Out of this work came a model called the  Yale attitude change approach , which describes the conditions under which people tend to change their attitudes. Hovland demonstrated that certain features of the source of a persuasive message, the content of the message, and the characteristics of the audience will influence the persuasiveness of a message (Hovland, Janis, & Kelley, 1953).

Features of the source of the persuasive message include the credibility of the speaker (Hovland & Weiss, 1951) and the physical attractiveness of the speaker (Eagly & Chaiken, 1975; Petty, Wegener, & Fabrigar, 1997). Thus, speakers who are credible, or have expertise on the topic, and who are deemed as trustworthy are more persuasive than less credible speakers. Similarly, more attractive speakers are more persuasive than less attractive speakers. The use of famous actors and athletes to advertise products on television and in print relies on this principle. The immediate and long term impact of the persuasion also depends, however, on the credibility of the messenger (Kumkale & Albarracín, 2004).

Features of the message itself that affect persuasion include subtlety (the quality of being important, but not obvious) (Petty & Cacioppo, 1986; Walster & Festinger, 1962); sidedness (that is, having more than one side) (Crowley & Hoyer, 1994; Igou & Bless, 2003; Lumsdaine & Janis, 1953); timing (Haugtvedt & Wegener, 1994; Miller & Campbell, 1959), and whether both sides are presented. Messages that are more subtle are more persuasive than direct messages. Arguments that occur first, such as in a debate, are more influential if messages are given back-to-back. However, if there is a delay after the first message, and before the audience needs to make a decision, the last message presented will tend to be more persuasive (Miller & Campbell, 1959).

Features of the audience that affect persuasion are attention (Albarracín & Wyer, 2001; Festinger & Maccoby, 1964), intelligence, self-esteem (Rhodes & Wood, 1992), and age (Krosnick & Alwin, 1989). In order to be persuaded, audience members must be paying attention. People with lower intelligence are more easily persuaded than people with higher intelligence; whereas people with moderate self-esteem are more easily persuaded than people with higher or lower self-esteem (Rhodes & Wood, 1992). Finally, younger adults aged 18–25 are more persuadable than older adults.

Elaboration Likelihood Model

An especially popular model that describes the dynamics of persuasion is the elaboration likelihood model of persuasion (Petty & Cacioppo, 1986). The  elaboration likelihood model  considers the variables of the attitude change approach—that is, features of the source of the persuasive message, contents of the message, and characteristics of the audience are used to determine when attitude change will occur. According to the elaboration likelihood model of persuasion, there are two main routes that play a role in delivering a persuasive message: central and peripheral ( Figure ).

The  central route  is logic driven and uses data and facts to convince people of an argument’s worthiness. For example, a car company seeking to persuade you to purchase their model will emphasize the car’s safety features and fuel economy. This is a direct route to persuasion that focuses on the quality of the information. In order for the central route of persuasion to be effective in changing attitudes, thoughts, and behaviors, the argument must be strong and, if successful, will result in lasting attitude change.

The central route to persuasion works best when the target of persuasion, or the audience, is analytical and willing to engage in processing of the information. From an advertiser’s perspective, what products would be best sold using the central route to persuasion? What audience would most likely be influenced to buy the product? One example is buying a computer. It is likely, for example, that small business owners might be especially influenced by the focus on the computer’s quality and features such as processing speed and memory capacity.

The  peripheral route  is an indirect route that uses peripheral cues to associate positivity with the message (Petty & Cacioppo, 1986). Instead of focusing on the facts and a product’s quality, the peripheral route relies on association with positive characteristics such as positive emotions and celebrity endorsement. For example, having a popular athlete advertise athletic shoes is a common method used to encourage young adults to purchase the shoes. This route to attitude change does not require much effort or information processing. This method of persuasion may promote positivity toward the message or product, but it typically results in less permanent attitude or behavior change. The audience does not need to be analytical or motivated to process the message. In fact, a peripheral route to persuasion may not even be noticed by the audience, for example in the strategy of product placement. Product placement refers to putting a product with a clear brand name or brand identity in a TV show or movie to promote the product (Gupta & Lord, 1998). For example, one season of the reality series  American Idol prominently showed the panel of judges drinking out of cups that displayed the Coca-Cola logo. What other products would be best sold using the peripheral route to persuasion? Another example is clothing: A retailer may focus on celebrities that are wearing the same style of clothing.

Foot-in-the-door Technique

Researchers have tested many persuasion strategies that are effective in selling products and changing people’s attitude, ideas, and behaviors. One effective strategy is the foot-in-the-door technique (Cialdini, 2001; Pliner, Hart, Kohl, & Saari, 1974). Using the  foot-in-the-door technique , the persuader gets a person to agree to bestow a small favor or to buy a small item, only to later request a larger favor or purchase of a bigger item. The foot-in-the-door technique was demonstrated in a study by Freedman and Fraser (1966) in which participants who agreed to post small sign in their yard or sign a petition were more likely to agree to put a large sign in their yard than people who declined the first request ( Figure ). Research on this technique also illustrates the principle of consistency (Cialdini, 2001): Our past behavior often directs our future behavior, and we have a desire to maintain consistency once we have a committed to a behavior.

A common application of foot-in-the-door is when teens ask their parents for a small permission (for example, extending curfew by a half hour) and then asking them for something larger. Having granted the smaller request increases the likelihood that parents will acquiesce with the later, larger request.

How would a store owner use the foot-in-the-door technique to sell you an expensive product? For example, say that you are buying the latest model smartphone, and the salesperson suggests you purchase the best data plan. You agree to this. The salesperson then suggests a bigger purchase—the three-year extended warranty. After agreeing to the smaller request, you are more likely to also agree to the larger request. You may have encountered this if you have bought a car. When salespeople realize that a buyer intends to purchase a certain model, they might try to get the customer to pay for many or most available options on the car.

Attitudes are our evaluations or feelings toward a person, idea, or object and typically are positive or negative. Our attitudes and beliefs are influenced not only by external forces, but also by internal influences that we control. An internal form of attitude change is cognitive dissonance or the tension we experience when our thoughts, feelings, and behaviors are in conflict. In order to reduce dissonance, individuals can change their behavior, attitudes, or cognitions, or add a new cognition. External forces of persuasion include advertising; the features of advertising that influence our behaviors include the source, message, and audience. There are two primary routes to persuasion. The central route to persuasion uses facts and information to persuade potential consumers. The peripheral route uses positive association with cues such as beauty, fame, and positive emotions.

Attitudes describe our ________ of people, objects, and ideas.

• evaluations

Cognitive dissonance causes discomfort because it disrupts our sense of ________.

• unpredictability
• consistency

In order for the central route to persuasion to be effective, the audience must be ________ and ________.

• analytical; motivated
• attentive; happy
• intelligent; unemotional
• gullible; distracted

Examples of cues used in peripheral route persuasion include all of the following  except

• celebrity endorsement
• positive emotions
• attractive models
• factual information

Give an example (one  not  used in class or your text) of cognitive dissonance and how an individual might resolve this.

Imagine that you work for an advertising agency, and you’ve been tasked with developing an advertising campaign to increase sales of Bliss Soda. How would you develop an advertisement for this product that uses a central route of persuasion? How would you develop an ad using a peripheral route of persuasion?

Cognitive dissonance often arises after making an important decision, called post-decision dissonance (or in popular terms, buyer’s remorse). Describe a recent decision you made that caused dissonance and describe how you resolved it.

Describe a time when you or someone you know used the foot-in-the-door technique to gain someone’s compliance.

[glossary-page] [glossary-term]attitude:[/glossary-term] [glossary-definition]evaluations of or feelings toward a person, idea, or object that are typically positive or negative[/glossary-definition]

[glossary-term]central route persuasion:[/glossary-term] [glossary-definition]logic-driven arguments using data and facts to convince people of an argument’s worthiness[/glossary-definition]

[glossary-term]cognitive dissonance:[/glossary-term] [glossary-definition]psychological discomfort that arises from a conflict in a person’s behaviors, attitudes, or beliefs that runs counter to one’s positive self-perception[/glossary-definition]

[glossary-term]foot-in-the-door technique:[/glossary-term] [glossary-definition]persuasion of one person by another person, encouraging a person to agree to a small favor, or to buy a small item, only to later request a larger favor or purchase of a larger item[/glossary-definition]

[glossary-term]peripheral route persuasion:[/glossary-term] [glossary-definition]one person persuades another person; an indirect route that relies on association of peripheral cues (such as positive emotions and celebrity endorsement) to associate positivity with a message[/glossary-definition]

[glossary-term]persuasion:[/glossary-term] [glossary-definition]process of changing our attitude toward something based on some form of communication[/glossary-definition]

[glossary-term]script:[/glossary-term] [glossary-definition]person’s knowledge about the sequence of events in a specific setting[/glossary-definition]

[glossary-term]social norm:[/glossary-term] [glossary-definition]group’s expectations regarding what is appropriate and acceptable for the thoughts and behavior of its members[/glossary-definition]

[glossary-term]social role:[/glossary-term] [glossary-definition]socially defined pattern of behavior that is expected of a person in a given setting or group[/glossary-definition]

[glossary-term]stanford prison experiment:[/glossary-term] [glossary-definition]Stanford University conducted an experiment in a mock prison that demonstrated the power of social roles, social norms, and scripts[/glossary-definition] [/glossary-page]

General Psychology Copyright © by Lumen Learning is licensed under a Creative Commons Attribution 4.0 International License , except where otherwise noted.

Share This Book

12.2 Self-presentation

Learning objectives.

By the end of this section, you will be able to:

• Describe social roles and how they influence behavior
• Explain what social norms are and how they influence behavior
• Define script
• Describe the findings and criticisms of Zimbardo’s Stanford prison experiment

As you’ve learned, social psychology is the study of how people affect one another’s thoughts, feelings, and behaviors. We have discussed situational perspectives and social psychology’s emphasis on the ways in which a person’s environment, including culture and other social influences, affect behavior. In this section, we examine situational forces that have a strong influence on human behavior including social roles, social norms, and scripts. We discuss how humans use the social environment as a source of information, or cues, on how to behave. Situational influences on our behavior have important consequences, such as whether we will help a stranger in an emergency or how we would behave in an unfamiliar environment.

Social Roles

One major social determinant of human behavior is our social roles. A social role is a pattern of behavior that is expected of a person in a given setting or group (Hare, 2003). Each one of us has several social roles. You may be, at the same time, a student, a parent, an aspiring teacher, a son or daughter, a spouse, and a lifeguard. How do these social roles influence your behavior? Social roles are defined by culturally shared knowledge. That is, nearly everyone in a given culture knows what behavior is expected of a person in a given role. For example, what is the social role for a student? If you look around a college classroom you will likely see students engaging in studious behavior, taking notes, listening to the professor, reading the textbook, and sitting quietly at their desks ( Figure 12.8 ). Of course you may see students deviating from the expected studious behavior such as texting on their phones or using Facebook on their laptops, but in all cases, the students that you observe are attending class—a part of the social role of students.

Social roles, and our related behavior, can vary across different settings. How do you behave when you are engaging in the role of a child attending a family function? Now imagine how you behave when you are engaged in the role of employee at your workplace. It is very likely that your behavior will be different. Perhaps you are more relaxed and outgoing with your family, making jokes and doing silly things. But at your workplace you might speak more professionally, and although you may be friendly, you are also serious and focused on getting the work completed. These are examples of how our social roles influence and often dictate our behavior to the extent that identity and personality can vary with context (that is, in different social groups) (Malloy, Albright, Kenny, Agatstein & Winquist, 1997).

Social Norms

As discussed previously, social roles are defined by a culture’s shared knowledge of what is expected behavior of an individual in a specific role. This shared knowledge comes from social norms. A social norm is a group’s expectation of what is appropriate and acceptable behavior for its members—how they are supposed to behave and think (Deutsch & Gerard, 1955; Berkowitz, 2004). How are we expected to act? What are we expected to talk about? What are we expected to wear? In our discussion of social roles we noted that colleges have social norms for students’ behavior in the role of student and workplaces have social norms for employees’ behaviors in the role of employee. Social norms are everywhere including in families, gangs, and on social media outlets. What are some social norms on Instagram?

Connect the Concepts

Tweens, teens, and social norms.

My 11-year-old daughter, Janelle, recently told me she needed shorts and shirts for the summer, and that she wanted me to take her to a store at the mall that is popular with preteens and teens to buy them. I have noticed that many girls have clothes from that store, so I tried teasing her. I said, “All the shirts say ‘Aero’ on the front. If you are wearing a shirt like that and you have a substitute teacher, and the other girls are all wearing that type of shirt, won’t the substitute teacher think you are all named ‘Aero’?”

My daughter replied, in typical 11-year-old fashion, “Mom, you are not funny. Can we please go shopping?”

I tried a different tactic. I asked Janelle if having clothing from that particular store will make her popular. She replied, “No, it will not make me popular. It is what the popular kids wear. It will make me feel happier.” How can a label or name brand make someone feel happier? Think back to what you’ve learned about lifespan development . What is it about pre-teens and young teens that make them want to fit in ( Figure 12.9 )? Does this change over time? Think back to your high school experience, or look around your college campus. What is the main name brand clothing you see? What messages do we get from the media about how to fit in?

Because of social roles, people tend to know what behavior is expected of them in specific, familiar settings. A script is a person’s knowledge about the sequence of events expected in a specific setting (Schank & Abelson, 1977). How do you act on the first day of school, when you walk into an elevator, or are at a restaurant? For example, at a restaurant in the United States, if we want the server’s attention, we try to make eye contact. In Brazil, you would make the sound “psst” to get the server’s attention. You can see the cultural differences in scripts. To an American, saying “psst” to a server might seem rude, yet to a Brazilian, trying to make eye contact might not seem an effective strategy. Scripts are important sources of information to guide behavior in given situations. Can you imagine being in an unfamiliar situation and not having a script for how to behave? This could be uncomfortable and confusing. How could you find out about social norms in an unfamiliar culture?

Zimbardo’s Stanford Prison Experiment

The famous Stanford prison experiment , conducted by social psychologist Philip Zimbardo and his colleagues at Stanford University, demonstrated the power of social roles, social norms, and scripts. In the summer of 1971, an advertisement was placed in a California newspaper asking for male volunteers to participate in a study about the psychological effects of prison life. More than 70 men volunteered, and these volunteers then underwent psychological testing to eliminate candidates who had underlying psychiatric issues, medical issues, or a history of crime or drug abuse. The pool of volunteers was whittled down to 24 healthy male college students. Each student was paid $15 per day (equivalent to about $80 today) and was randomly assigned to play the role of either a prisoner or a guard in the study. Based on what you have learned about research methods, why is it important that participants were randomly assigned?

A mock prison was constructed in the basement of the psychology building at Stanford. Participants assigned to play the role of prisoners were “arrested” at their homes by Palo Alto police officers, booked at a police station, and subsequently taken to the mock prison. The experiment was scheduled to run for several weeks. To the surprise of the researchers, both the “prisoners” and “guards” assumed their roles with zeal. On the second day of the experiment, the guards forced the prisoners to strip, took their beds, and isolated the ringleaders using solitary confinement. In a relatively short time, the guards came to harass the prisoners in an increasingly sadistic manner, through a complete lack of privacy, lack of basic comforts such as mattresses to sleep on, and through degrading chores and late-night counts.

The prisoners, in turn, began to show signs of severe anxiety and hopelessness—they began tolerating the guards’ abuse. Even the Stanford professor who designed the study and was the head researcher, Philip Zimbardo, found himself acting as if the prison was real and his role, as prison supervisor, was real as well. After only six days, the experiment had to be ended due to the participants’ deteriorating behavior. Zimbardo explained,

At this point it became clear that we had to end the study. We had created an overwhelmingly powerful situation—a situation in which prisoners were withdrawing and behaving in pathological ways, and in which some of the guards were behaving sadistically. Even the “good” guards felt helpless to intervene, and none of the guards quit while the study was in progress. Indeed, it should be noted that no guard ever came late for his shift, called in sick, left early, or demanded extra pay for overtime work. (Zimbardo, 2013)

The Stanford Prison Experiment has been used as a memorable demonstration of the incredible power that social roles, norms, and scripts have in affecting human behavior. However, multiple aspects of the study have been subject to criticism since its inception. The nature of these criticisms range from ethical concerns to issues of generalizability (Bartels, Milovich, & Moussier, 2016; Griggs, 2014; Le Texier, 2019). One criticism is that the way students were recruited for the experiment may have impacted the outcome (Carnahan & McFarland, 2007). Another criticism questions the conclusions that can be drawn from the study. Zimbardo appears to have provided specific guidelines of the types of behaviors that were expected of the guards (Zimbardo, 2007). Subsequent research suggests that such guidelines likely created an expectation of the types of behavior that Zimbardo reported observing in the Stanford Prison Experiment (Bartels, 2019), and that given these expectations, the guards simply acted as they thought they were expected to act. It has also been problematic that attempts to replicate aspects of the study have not been successful. For example, when no guidelines were presented to the guards, researchers documented different outcomes than those observed by Zimbardo. (Reicher & Haslam, 2006).

The Stanford Prison Experiment has some parallels with the abuse of prisoners of war by U.S. Army troops and CIA personnel at the Abu Ghraib prison in 2003 and 2004 during the Iraq War. The offenses at Abu Ghraib were documented by photographs of the abuse, some taken by the abusers themselves ( Figure 12.10 ).

Link to Learning

Listen to this NPR interview with Philip Zimbardo where he discusses the parallels between the Stanford prison experiment and the Abu Ghraib prison in Iraq to learn more.

As an Amazon Associate we earn from qualifying purchases.

This book may not be used in the training of large language models or otherwise be ingested into large language models or generative AI offerings without OpenStax's permission.

Want to cite, share, or modify this book? This book uses the Creative Commons Attribution License and you must attribute OpenStax.

Access for free at https://openstax.org/books/psychology-2e/pages/1-introduction

• Authors: Rose M. Spielman, William J. Jenkins, Marilyn D. Lovett
• Publisher/website: OpenStax
• Book title: Psychology 2e
• Publication date: Apr 22, 2020
• Location: Houston, Texas
• Book URL: https://openstax.org/books/psychology-2e/pages/1-introduction
• Section URL: https://openstax.org/books/psychology-2e/pages/12-2-self-presentation

© Jan 6, 2024 OpenStax. Textbook content produced by OpenStax is licensed under a Creative Commons Attribution License . The OpenStax name, OpenStax logo, OpenStax book covers, OpenStax CNX name, and OpenStax CNX logo are not subject to the Creative Commons license and may not be reproduced without the prior and express written consent of Rice University.

• PRESENTATION SKILLS

Self-Presentation in Presentations

Search SkillsYouNeed:

Presentation Skills:

• A - Z List of Presentation Skills
• Top Tips for Effective Presentations
• General Presentation Skills
• What is a Presentation?
• Preparing for a Presentation
• Organising the Material
• Writing Your Presentation
• Deciding the Presentation Method
• Managing your Presentation Notes
• Working with Visual Aids
• Presenting Data
• Managing the Event
• Coping with Presentation Nerves
• Dealing with Questions
• How to Build Presentations Like a Consultant
• 7 Qualities of Good Speakers That Can Help You Be More Successful
• Specific Presentation Events
• Remote Meetings and Presentations
• Giving a Speech
• Presentations in Interviews
• Presenting to Large Groups and Conferences
• Giving Lectures and Seminars
• Managing a Press Conference
• Attending Public Consultation Meetings
• Managing a Public Consultation Meeting
• Crisis Communications
• Elsewhere on Skills You Need:
• Communication Skills
• Facilitation Skills
• Teams, Groups and Meetings
• Effective Speaking
• Question Types

Subscribe to our FREE newsletter and start improving your life in just 5 minutes a day.

You'll get our 5 free 'One Minute Life Skills' and our weekly newsletter.

We'll never share your email address and you can unsubscribe at any time.

When you give a presentation, it is important to remember the whole package, and that means how you present yourself as well as how you present the material.

It is not good to spend hours and hours preparing a wonderful presentation and neglect the effect of your own appearance.

Whether you like it or not, people make judgements about you based on your appearance.

These judgements may be conscious or subconscious, but they all affect how, and whether, your audience is prepared to take on board your message as presenter.

Our pages on Personal Appearance and Personal Presentation explain the importance of presenting yourself effectively, more generally. This page focuses on the impact of self-presentation in presentations.

The Importance of Expectations

When you stand up to give a presentation, the audience already has certain expectations about how you will behave, and what you will say.

These expectations may be based on the event, the marketing, their knowledge of you, or their previous experience more generally.

Expectations may also be based on societal norms, such as business people are expected to wear suits.

You don’t have to match people’s expectations, of course, but you do need to be aware that, if you don’t, they are going to have to spend time processing that difference. This mismatch will take some of their concentration away from your message.

You also need to be aware that people can only take so much discomfort.

A mismatch between expectations and reality can even lead to a situation called cognitive dissonance , where individuals come into contact with something — whether idea, person, or belief — that causes them to question their own internal beliefs and values.

This can be very uncomfortable, and the normal reaction is to try to avoid it. In a presentation situation, that's going to mean either leaving or just not listening, neither of which is ideal.

This is particularly important if you want to say something that your audience will find difficult to hear.

If you want to say something outrageous, wear a suit.

The late Dr Joe Jaina, Organisational Psychologist at Cranfield School of Management.

Aspects of Personal Presentation

Your personal presentation includes:

• Accessories, which in this context means anything that you’re carrying or wearing, including your notes, although it also includes luggage, bags, phones, jewellery, watches, and scarves;
• Body language; and

Your clothes are probably the most obvious aspect of personal presentation.

In deciding what to wear, there are several things to consider:

What does the audience expect?

It’s not actually as simple as ‘wear a business suit’, because this may not always be appropriate.

It does depend what your audience is expecting. On some occasions, or in some industries, smart casual may be much more appropriate. If you’re not sure, ask the organisers about the dress code. You can also ask someone who has been to the event before, or have a look online.

If it’s a regular event, there will almost certainly be photographs of previous occasions and you can see what other people have worn.

Within the audience’s expectations, what will make you feel comfortable?

You will present best if you are fairly relaxed, so you need to find a balance between the audience’s expectations, and feeling comfortable.

For example, you may have a particular suit that you think makes you look good. For women, it’s also worth thinking about shoes: you’re going to have to stand for the duration of the session, so make sure that you can do that.

If you’re not used to heels, don’t wear them.

Your accessories should be consistent with your clothes.

That doesn’t mean that your bag needs to be the same colour as your jacket.  However, if you’re wearing a suit, your notes should be in a briefcase or smart bag, and you’re not carrying a backpack or plastic carrier bag. Again, it’s about not distracting your audience from your message.

Likewise, your notes should be part of your thinking. Producing a dog-eared sheaf of paper is not going to help you project a good image. Papers tend to flap about, whereas cue cards can be held on your hand, which is why it is worth considering using cue cards, or even memorising most of what you’re going to say and using your visual aids as cues.

See our page: Managing your Presentation Notes for more on this.

The Importance of Self-Presentation

In 2005, the Conservative Party in the UK faced a leadership election as leader Michael Howard announced that he would step down. The actual election was held between October and December that year. In October, at the Conservative Party Conference, each of the announced candidates was given an opportunity to make a 20-minute speech.

Before the speeches, David Davis was very much the front-runner in the competition. However, his conference speech was considered poor. He spoke from notes, and never really came alive. David Cameron, a more junior member of the party and considered by many an outside chance as leader, made a speech that set the hall alight. He spoke without notes, and with passion, presenting himself as the young, upcoming potential leader who could take the party in a new direction.

By the following morning, the bookies had David Cameron as the front-runner and he went on to win the leadership election.

Self-Presentation also Includes Body Language and Voice.

While there are many important elements of body language, perhaps the most important is to project self-confidence .

You need to demonstrate that you believe in what you’re saying. Otherwise, why would anyone else believe it?

For more about this, and other aspects of body language that may help your communication, see our pages on Managing a Presentation Event and Non-Verbal Communication .

Part of projecting self-belief is being able to control your voice, and speak slowly and clearly. You also need to vary your tone and pace to keep people interested.

For more about this, see our page on Effective Speaking .

In conclusion…

When you are making a presentation, you are presenting a package: you and your message. The more you are aware of the impact of every element, the more effective the package will be as a whole.

Further Reading from Skills You Need

The Skills You Need Guide to Getting a Job

Develop the skills you need to get that job.

This eBook is essential reading for potential job-seekers. Not only does it cover identifying your skills but also the mechanics of applying for a job, writing a CV or resume and attending interviews.

Continue to: Presenting to Large Groups Top Tips for Effective Presentations

See also: Coping with Presentation Nerves Giving a Speech Presenting Data Building a Personal Brand

• Personality

Self-Presentation in the Digital World

Do traditional personality theories predict digital behaviour.

Posted August 31, 2021 | Reviewed by Chloe Williams

• What Is Personality?
• Take our Agreeableness Test
• Find a therapist near me
• Personality theories can help explain real-world differences in self-presentation behaviours but they may not apply to online behaviours.
• In the real world, women have higher levels of behavioural inhibition tendencies than men and are more likely to avoid displeasing others.
• Based on this assumption, one would expect women to present themselves less on social media, but women tend to use social media more than men.

Digital technology allows people to construct and vary their self-identity more easily than they can in the real world. This novel digital- personality construction may, or may not, be helpful to that person in the long run, but it is certainly more possible than it is in the real world. Yet how this relates to "personality," as described by traditional personality theories, is not really known. Who will tend to manipulate their personality online, and would traditional personality theories predict these effects? A look at what we do know about gender differences in the real and digital worlds suggests that many aspects of digital behaviour may not conform to the expectations of personality theories developed for the real world.

Half a century ago, Goffman suggested that individuals establish social identities by employing self-presentation tactics and impression management . Self-presentational tactics are techniques for constructing or manipulating others’ impressions of the individual and ultimately help to develop that person’s identity in the eyes of the world. The ways other people react are altered by choosing how to present oneself – that is, self-presentation strategies are used for impression management . Others then uphold, shape, or alter that self-image , depending on how they react to the tactics employed. This implies that self-presentation is a form of social communication, by which people establish, maintain, and alter their social identity.

These self-presentational strategies can be " assertive " or "defensive." 1 Assertive strategies are associated with active control of the person’s self-image; and defensive strategies are associated with protecting a desired identity that is under threat. In the real world, the use of self-presentational tactics has been widely studied and has been found to relate to many behaviours and personalities 2 . Yet, despite the enormous amounts of time spent on social media , the types of self-presentational tactics employed on these platforms have not received a huge amount of study. In fact, social media appears to provide an ideal opportunity for the use of self-presentational tactics, especially assertive strategies aimed at creating an identity in the eyes of others.

Seeking to Experience Different Types of Reward

Social media allows individuals to present themselves in ways that are entirely reliant on their own behaviours – and not on factors largely beyond their ability to instantly control, such as their appearance, gender, etc. That is, the impression that the viewer of the social media post receives is dependent, almost entirely, on how or what another person posts 3,4 . Thus, the digital medium does not present the difficulties for individuals who wish to divorce the newly-presented self from the established self. New personalities or "images" may be difficult to establish in real-world interactions, as others may have known the person beforehand, and their established patterns of interaction. Alternatively, others may not let people get away with "out of character" behaviours, or they may react to their stereotype of the person in front of them, not to their actual behaviours. All of which makes real-life identity construction harder.

Engaging in such impression management may stem from motivations to experience different types of reward 5 . In terms of one personality theory, individuals displaying behavioural approach tendencies (the Behavioural Activation System; BAS) and behavioural inhibition tendencies (the Behavioural Inhibition System; BIS) will differ in terms of self-presentation behaviours. Those with strong BAS seek opportunities to receive or experience reward (approach motivation ); whereas, those with strong BIS attempt to avoid punishment (avoidance motivation). People who need to receive a lot of external praise may actively seek out social interactions and develop a lot of social goals in their lives. Those who are more concerned about not incurring other people’s displeasure may seek to defend against this possibility and tend to withdraw from people. Although this is a well-established view of personality in the real world, it has not received strong attention in terms of digital behaviours.

Real-World Personality Theories May Not Apply Online

One test bed for the application of this theory in the digital domain is predicted gender differences in social media behaviour in relation to self-presentation. Both self-presentation 1 , and BAS and BIS 6 , have been noted to show gender differences. In the real world, women have shown higher levels of BIS than men (at least, to this point in time), although levels of BAS are less clearly differentiated between genders. This view would suggest that, in order to avoid disapproval, women will present themselves less often on social media; and, where they do have a presence, adopt defensive self-presentational strategies.

The first of these hypotheses is demonstrably false – where there are any differences in usage (and there are not that many), women tend to use social media more often than men. What we don’t really know, with any certainty, is how women use social media for self-presentation, and whether this differs from men’s usage. In contrast to the BAS/BIS view of personality, developed for the real world, several studies have suggested that selfie posting can be an assertive, or even aggressive, behaviour for females – used in forming a new personality 3 . In contrast, sometimes selfie posting by males is related to less aggressive, and more defensive, aspects of personality 7 . It may be that women take the opportunity to present very different images of themselves online from their real-world personalities. All of this suggests that theories developed for personality in the real world may not apply online – certainly not in terms of putative gender-related behaviours.

We know that social media allows a new personality to be presented easily, which is not usually seen in real-world interactions, and it may be that real-world gender differences are not repeated in digital contexts. Alternatively, it may suggest that these personality theories are now simply hopelessly anachronistic – based on assumptions that no longer apply. If that were the case, it would certainly rule out any suggestion that such personalities are genetically determined – as we know that structure hasn’t changed dramatically in the last 20 years.

1. Lee, S.J., Quigley, B.M., Nesler, M.S., Corbett, A.B., & Tedeschi, J.T. (1999). Development of a self-presentation tactics scale. Personality and Individual Differences, 26(4), 701-722.

2. Laghi, F., Pallini, S., & Baiocco, R. (2015). Autopresentazione efficace, tattiche difensive e assertive e caratteristiche di personalità in Adolescenza. Rassegna di Psicologia, 32(3), 65-82.

3. Chua, T.H.H., & Chang, L. (2016). Follow me and like my beautiful selfies: Singapore teenage girls’ engagement in self-presentation and peer comparison on social media. Computers in Human Behavior, 55, 190-197.

4. Fox, J., & Rooney, M.C. (2015). The Dark Triad and trait self-objectification as predictors of men’s use and self-presentation behaviors on social networking sites. Personality and Individual Differences, 76, 161-165.

5. Hermann, A.D., Teutemacher, A.M., & Lehtman, M.J. (2015). Revisiting the unmitigated approach model of narcissism: Replication and extension. Journal of Research in Personality, 55, 41-45.

6. Carver, C.S., & White, T.L. (1994). Behavioral inhibition, behavioral activation, and affective responses to impending reward and punishment: the BIS/BAS scales. Journal of Personality and Social Psychology, 67(2), 319.

7. Sorokowski, P., Sorokowska, A., Frackowiak, T., Karwowski, M., Rusicka, I., & Oleszkiewicz, A. (2016). Sex differences in online selfie posting behaviors predict histrionic personality scores among men but not women. Computers in Human Behavior, 59, 368-373.

Phil Reed, Ph.D., is a professor of psychology at Swansea University.

• Find a Therapist
• Find a Treatment Center
• Find a Psychiatrist
• Find a Support Group
• Find Online Therapy
• United States
• Brooklyn, NY
• Chicago, IL
• Houston, TX
• Los Angeles, CA
• New York, NY
• Portland, OR
• San Diego, CA
• San Francisco, CA
• Seattle, WA
• Washington, DC
• Asperger's
• Bipolar Disorder
• Chronic Pain
• Eating Disorders
• Passive Aggression
• Goal Setting
• Positive Psychology
• Stopping Smoking
• Low Sexual Desire
• Relationships
• Child Development
• Self Tests NEW
• Therapy Center
• Diagnosis Dictionary
• Types of Therapy

Sticking up for yourself is no easy task. But there are concrete skills you can use to hone your assertiveness and advocate for yourself.

• Emotional Intelligence
• Gaslighting
• Affective Forecasting
• Neuroscience

71 Self-presentation

[latexpage]

Learning Objectives

By the end of this section, you will be able to:

• Describe social roles and how they influence behavior
• Explain what social norms are and how they influence behavior
• Define script
• Describe the findings of Zimbardo’s Stanford prison experiment

As you’ve learned, social psychology is the study of how people affect one another’s thoughts, feelings, and behaviors. We have discussed situational perspectives and social psychology’s emphasis on the ways in which a person’s environment, including culture and other social influences, affect behavior. In this section, we examine situational forces that have a strong influence on human behavior including social roles, social norms, and scripts. We discuss how humans use the social environment as a source of information, or cues, on how to behave. Situational influences on our behavior have important consequences, such as whether we will help a stranger in an emergency or how we would behave in an unfamiliar environment.

SOCIAL ROLES

One major social determinant of human behavior is our social roles. A social role is a pattern of behavior that is expected of a person in a given setting or group (Hare, 2003). Each one of us has several social roles. You may be, at the same time, a student, a parent, an aspiring teacher, a son or daughter, a spouse, and a lifeguard. How do these social roles influence your behavior? Social roles are defined by culturally shared knowledge. That is, nearly everyone in a given culture knows what behavior is expected of a person in a given role. For example, what is the social role for a student? If you look around a college classroom you will likely see students engaging in studious behavior, taking notes, listening to the professor, reading the textbook, and sitting quietly at their desks ( [link] ). Of course you may see students deviating from the expected studious behavior such as texting on their phones or using Facebook on their laptops, but in all cases, the students that you observe are attending class—a part of the social role of students.

Social roles, and our related behavior, can vary across different settings. How do you behave when you are engaging in the role of son or daughter and attending a family function? Now imagine how you behave when you are engaged in the role of employee at your workplace. It is very likely that your behavior will be different. Perhaps you are more relaxed and outgoing with your family, making jokes and doing silly things. But at your workplace you might speak more professionally, and although you may be friendly, you are also serious and focused on getting the work completed. These are examples of how our social roles influence and often dictate our behavior to the extent that identity and personality can vary with context (that is, in different social groups) (Malloy, Albright, Kenny, Agatstein & Winquist, 1997).

SOCIAL NORMS

As discussed previously, social roles are defined by a culture’s shared knowledge of what is expected behavior of an individual in a specific role. This shared knowledge comes from social norms. A social norm is a group’s expectation of what is appropriate and acceptable behavior for its members—how they are supposed to behave and think (Deutsch & Gerard, 1955; Berkowitz, 2004). How are we expected to act? What are we expected to talk about? What are we expected to wear? In our discussion of social roles we noted that colleges have social norms for students’ behavior in the role of student and workplaces have social norms for employees’ behaviors in the role of employee. Social norms are everywhere including in families, gangs, and on social media outlets. What are some social norms on Facebook?

My 11-year-old daughter, Jessica, recently told me she needed shorts and shirts for the summer, and that she wanted me to take her to a store at the mall that is popular with preteens and teens to buy them. I have noticed that many girls have clothes from that store, so I tried teasing her. I said, “All the shirts say ‘Aero’ on the front. If you are wearing a shirt like that and you have a substitute teacher, and the other girls are all wearing that type of shirt, won’t the substitute teacher think you are all named ‘Aero’?”

My daughter replied, in typical 11-year-old fashion, “Mom, you are not funny. Can we please go shopping?”

I tried a different tactic. I asked Jessica if having clothing from that particular store will make her popular. She replied, “No, it will not make me popular. It is what the popular kids wear. It will make me feel happier.” How can a label or name brand make someone feel happier? Think back to what you’ve learned about lifespan development . What is it about pre-teens and young teens that make them want to fit in ( [link] )? Does this change over time? Think back to your high school experience, or look around your college campus. What is the main name brand clothing you see? What messages do we get from the media about how to fit in?

Because of social roles, people tend to know what behavior is expected of them in specific, familiar settings. A script is a person’s knowledge about the sequence of events expected in a specific setting (Schank & Abelson, 1977). How do you act on the first day of school, when you walk into an elevator, or are at a restaurant? For example, at a restaurant in the United States, if we want the server’s attention, we try to make eye contact. In Brazil, you would make the sound “psst” to get the server’s attention. You can see the cultural differences in scripts. To an American, saying “psst” to a server might seem rude, yet to a Brazilian, trying to make eye contact might not seem an effective strategy. Scripts are important sources of information to guide behavior in given situations. Can you imagine being in an unfamiliar situation and not having a script for how to behave? This could be uncomfortable and confusing. How could you find out about social norms in an unfamiliar culture?

ZIMBARDO’S STANFORD PRISON EXPERIMENT

The famous Stanford prison experiment , conducted by social psychologist Philip Zimbardo and his colleagues at Stanford University, demonstrated the power of social roles, social norms, and scripts. In the summer of 1971, an advertisement was placed in a California newspaper asking for male volunteers to participate in a study about the psychological effects of prison life. More than 70 men volunteered, and these volunteers then underwent psychological testing to eliminate candidates who had underlying psychiatric issues, medical issues, or a history of crime or drug abuse. The pool of volunteers was whittled down to 24 healthy male college students. Each student was paid $15 per day and was randomly assigned to play the role of either a prisoner or a guard in the study. Based on what you have learned about research methods, why is it important that participants were randomly assigned?

A mock prison was constructed in the basement of the psychology building at Stanford. Participants assigned to play the role of prisoners were “arrested” at their homes by Palo Alto police officers, booked at a police station, and subsequently taken to the mock prison. The experiment was scheduled to run for several weeks. To the surprise of the researchers, both the “prisoners” and “guards” assumed their roles with zeal. In fact, on day 2, some of the prisoners revolted, and the guards quelled the rebellion by threatening the prisoners with night sticks. In a relatively short time, the guards came to harass the prisoners in an increasingly sadistic manner, through a complete lack of privacy, lack of basic comforts such as mattresses to sleep on, and through degrading chores and late-night counts.

The prisoners, in turn, began to show signs of severe anxiety and hopelessness—they began tolerating the guards’ abuse. Even the Stanford professor who designed the study and was the head researcher, Philip Zimbardo, found himself acting as if the prison was real and his role, as prison supervisor, was real as well. After only six days, the experiment had to be ended due to the participants’ deteriorating behavior. Zimbardo explained,

At this point it became clear that we had to end the study. We had created an overwhelmingly powerful situation—a situation in which prisoners were withdrawing and behaving in pathological ways, and in which some of the guards were behaving sadistically. Even the “good” guards felt helpless to intervene, and none of the guards quit while the study was in progress. Indeed, it should be noted that no guard ever came late for his shift, called in sick, left early, or demanded extra pay for overtime work. (Zimbardo, 2013)

The Stanford prison experiment demonstrated the power of social roles, norms, and scripts in affecting human behavior. The guards and prisoners enacted their social roles by engaging in behaviors appropriate to the roles: The guards gave orders and the prisoners followed orders. Social norms require guards to be authoritarian and prisoners to be submissive. When prisoners rebelled, they violated these social norms, which led to upheaval. The specific acts engaged by the guards and the prisoners derived from scripts. For example, guards degraded the prisoners by forcing them do push-ups and by removing all privacy. Prisoners rebelled by throwing pillows and trashing their cells. Some prisoners became so immersed in their roles that they exhibited symptoms of mental breakdown; however, according to Zimbardo, none of the participants suffered long term harm (Alexander, 2001).

The Stanford Prison Experiment has some parallels with the abuse of prisoners of war by U.S. Army troops and CIA personnel at the Abu Ghraib prison in 2003 and 2004. The offenses at Abu Ghraib were documented by photographs of the abuse, some taken by the abusers themselves ( [link] ).

Visit this website to hear an NPR interview with Philip Zimbardo where he discusses the parallels between the Stanford prison experiment and the Abu Ghraib prison in Iraq.

Human behavior is largely influenced by our social roles, norms, and scripts. In order to know how to act in a given situation, we have shared cultural knowledge of how to behave depending on our role in society. Social norms dictate the behavior that is appropriate or inappropriate for each role. Each social role has scripts that help humans learn the sequence of appropriate behaviors in a given setting. The famous Stanford prison experiment is an example of how the power of the situation can dictate the social roles, norms, and scripts we follow in a given situation, even if this behavior is contrary to our typical behavior.

Review Questions

A(n) ________ is a set of group expectations for appropriate thoughts and behaviors of its members.

• social role
• social norm
• attribution

On his first day of soccer practice, Jose suits up in a t-shirt, shorts, and cleats and runs out to the field to join his teammates. Jose’s behavior is reflective of ________.

• social influence
• good athletic behavior
• normative behavior

When it comes to buying clothes, teenagers often follow social norms; this is likely motivated by ________.

• following parents’ rules
• saving money
• looking good

In the Stanford prison experiment, even the lead researcher succumbed to his role as a prison supervisor. This is an example of the power of ________ influencing behavior.

• social norms
• social roles

Critical Thinking Questions

Why didn’t the “good” guards in the Stanford prison experiment object to other guards’ abusive behavior? Were the student prisoners simply weak people? Why didn’t they object to being abused?

The good guards were fulfilling their social roles and they did not object to other guards’ abusive behavior because of the power of the situation. In addition, the prison supervisor’s behavior sanctioned the guards’ negative treatment of prisoners. The prisoners were not weak people; they were recruited because they were healthy, mentally stable adults. The power of their social role influenced them to engage in subservient prisoner behavior. The script for prisoners is to accept abusive behavior from authority figures, especially for punishment, when they do not follow the rules.

Describe how social roles, social norms, and scripts were evident in the Stanford prison experiment. How can this experiment be applied to everyday life? Are there any more recent examples where people started fulfilling a role and became abusive?

Social roles were in play as each participant acted out behaviors appropriate to his role as prisoner, guard, or supervisor. Scripts determined the specific behaviors the guards and prisoners displayed, such as humiliation and passivity. The social norms of a prison environment sanctions abuse of prisoners since they have lost many of their human rights and became the property of the government. This experiment can be applied to other situations in which social norms, roles, and scripts dictate our behavior, such as in mob behavior. A more recent example of similar behavior was the abuse of prisoners by American soldiers who were working as prison guards at the Abu Ghraib prison in Iraq.

Personal Application Questions

Try attending a religious service very different from your own and see how you feel and behave without knowing the appropriate script. Or, try attending an important, personal event that you have never attended before, such as a bar mitzvah (a coming-of-age ritual in Jewish culture), a quinceañera (in some Latin American cultures a party is given to a girl who is turning 15 years old), a wedding, a funeral, or a sporting event new to you, such as horse racing or bull riding. Observe and record your feelings and behaviors in this unfamiliar setting for which you lack the appropriate script. Do you silently observe the action, or do you ask another person for help interpreting the behaviors of people at the event? Describe in what ways your behavior would change if you were to attend a similar event in the future?

Name and describe at least three social roles you have adopted for yourself. Why did you adopt these roles? What are some roles that are expected of you, but that you try to resist?

Share This Book

• Increase Font Size

• SUGGESTED TOPICS
• The Magazine
• Newsletters
• Managing Yourself
• Managing Teams
• Work-life Balance
• The Big Idea
• Data & Visuals
• Reading Lists
• Case Selections
• HBR Learning
• Topic Feeds
• Account Settings
• Email Preferences

A Simple Way to Introduce Yourself

• Andrea Wojnicki

Think: present, past, future.

Many of us dread the self-introduction, be it in an online meeting or at the boardroom table. Here is a practical framework you can leverage to introduce yourself with confidence in any context, online or in-person: Present, past, and future. You can customize this framework both for yourself as an individual and for the specific context. Perhaps most importantly, when you use this framework, you will be able to focus on others’ introductions, instead of stewing about what you should say about yourself.

You know the scenario. It could be in an online meeting, or perhaps you are seated around a boardroom table. The meeting leader asks everyone to briefly introduce themselves. Suddenly, your brain goes into hyperdrive. What should I say about myself?

• Andrea Wojnicki , MBA, DBA, is an executive communication coach and founder of Talk About Talk, a multi-media learning resource to help executives improve their communication skills.

Partner Center

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• Front Psychol

Eighty phenomena about the self: representation, evaluation, regulation, and change

Paul thagard.

1 Department of Philosophy, University of Waterloo, Waterloo, ON, Canada

Joanne V. Wood

2 Department of Psychology, University of Waterloo, Waterloo, ON, Canada

We propose a new approach for examining self-related aspects and phenomena. The approach includes (1) a taxonomy and (2) an emphasis on multiple levels of mechanisms. The taxonomy categorizes approximately eighty self-related phenomena according to three primary functions involving the self: representing, effecting, and changing. The representing self encompasses the ways in which people depict themselves, either to themselves or to others (e.g., self-concepts, self-presentation). The effecting self concerns ways in which people facilitate or limit their own traits and behaviors (e.g., self-enhancement, self-regulation). The changing self is less time-limited than the effecting self; it concerns phenomena that involve lasting alterations in how people represent and control themselves (e.g., self-expansion, self-development). Each self-related phenomenon within these three categories may be examined at four levels of interacting mechanisms (social, individual, neural, and molecular). We illustrate our approach by focusing on seven self-related phenomena.

Introduction

Social and clinical psychologists frequently use the concept of the self in their discussions of a wide range of phenomena (e.g., Baumeister, 1999 ; Sedikides and Brewer, 2001 ; Leary and Tangney, 2003 ; Alicke et al., 2005 ; Sedikides and Spencer, 2007 ). However, there is no general, unified psychological theory of the self that can account for these phenomena. Thagard (2014) has proposed a view of the self as a multilevel system consisting of social, individual, neural, and molecular mechanisms. Like James (1890) and Mead (1967) , this view accommodates social, cognitive, and physiological aspects of the self, but provides far more detail about the nature of the relevant mechanisms. Our aim in the current paper is to show the applicability of the multilevel system account of the self to a large range of phenomena.

We will present a new taxonomy that categorizes approximately eighty self-related phenomena according to three primary aspects of the self: representing, effecting, and changing. The representing self encompasses the ways in which people depict themselves, either to themselves or to others (e.g., self-concepts, self-presentation). The effecting self concerns ways in which people facilitate or limit their own traits and behaviors (e.g., self-enhancement, self-regulation). The changing self is less time-limited than the effecting self; it concerns phenomena that involve lasting alterations in how people represent and control themselves (e.g., self-expansion, self-development). After presenting this taxonomy, we will describe how four levels of mechanisms—social, individual, neural, and molecular—are relevant to understanding these phenomena about the self. It would be premature to offer a full theory of the self, because not enough is known about the nature of these mechanisms and how they produce the relevant phenomena. But we hope our taxonomy and outline of relevant mechanisms provides a new and useful framework for theorizing about the self.

A Taxonomy of Self-Phenomena

There are more than eighty frequently discussed topics that we call the self-phenomena. More accurately, each of these topics should be understood as a group of phenomena. For example, there are many empirical findings about self-esteem that should count as distinctive phenomena to be explained, so there are potentially hundreds of findings for which a scientific theory of the self should be able to account.

Fortunately, the task of accounting for all of the self-phenomena, through causal explanations of the large number of empirical findings about them, can be managed by grouping the phenomena according to three primary aspects of the self: representing, effecting, and changing. All of the self-phenomena fall primarily under one of these functional groups, although a few are related to more than one group. Figure ​ Figure1 1 summarizes the proposed organization of self-phenomena that we now discuss in more detail.

Grouping of many self-phenomena into six main classes: self-representing (with three sub-categories), self-effecting (with two sub-categories), and self-changing. Source: Thagard (2014) .

The Representing Self

A representation is a structure or activity that stands for something, and many of the self-phenomena listed in Figure ​ Figure1 1 concern ways in which people represent themselves. The representing self can roughly be divided into three subgroups concerned with (1) depicting oneself to oneself, (2) depicting oneself to others, and (3) evaluating oneself according to one’s own standards.

The most general terms for depicting oneself to oneself are self-knowledge and self-understanding, which seem roughly equivalent. Self-concepts and self-schemata are both mental ingredients of self-knowledge, serving as cognitive structures to represent different aspects of the self. (Later we provide a more detailed account of self-concepts.) Self-interest consists in the collection of one’s personal goals, conscious or unconscious. Self-identity and self-image are also ways in which one represents oneself to oneself, although they may also contribute to how one represents oneself to others. Self-discovery and self-projection are processes that involve self-representation.

Several aspects of depicting oneself to oneself assume conscious experience, as in self-awareness and other phenomena listed in Figure ​ Figure1. 1 . Such experience is not purely cognitive, as it can also involve prominent affective components such as moods and emotions. Another set of phenomena that involve depicting oneself to oneself includes self-deception and self-delusion, in which the representation of self is false. The second division within the group of self-representing phenomena involves depicting and communicating oneself to others.

The third sub-group of self-phenomena in the representing category concerns the evaluation of the self, either as on ongoing process or as the product that results from the evaluation. Phenomena concerned with the process of evaluation include self-appraisal. There are many products that result from this process, including both general assessments such as self-confidence and particular emotional reactions such as self-pity.

The Effecting Self

The self does more than just represent itself; it also does things to itself, including facilitating its own functioning in desirable ways and limiting its functioning to prevent undesirable consequences. Self-phenomena that have a facilitating effect include self-actualization. Self-evaluation can also produce the self-knowledge that unconstrained actions may have undesirable consequences, as in excessive eating, drinking, drug use, and dangerous liaisons. Accordingly, there is a set of important phenomena concerning limits that people put on their own behavior, including self-control. All of these self-effecting phenomena involve people encouraging or discouraging their own behaviors, but they do not bring about fundamental, longer lasting changes in the self, which is the third and probably rarest aspect of the self.

The Changing Self

Over a lifetime, people change as the result of aging and experiences such as major life events. Some self-phenomena such as self-development concern processes of change. The changes can involve alterations in self-representing, when people come to apply different concepts to themselves, and also self-effecting, if people manage to change the degree to which they are capable of either facilitating desired behaviors or limiting undesired ones. Whereas short-term psychotherapy is aimed at dealing with small-scale problems in self-representing and self-efficacy, long-term psychotherapy may aim at larger alterations in the underlying nature of the self.

The proposed grouping of self-phenomena summarized in Figure ​ Figure1 1 is not meant to be exhaustive, as there are aspects of self that are described by words without the “self” prefix, such as agency, autonomy, personhood, and resilience, as well as more esoteric terms that do use the prefix. But the diagram serves to provide an idea of the large range of phenomena concerning the self. Our goal is to show the applicability of the multilevel account of the self to this range of phenomena, by selecting phenomena from each of the six main classes in Figure ​ Figure1. 1 . It would be tedious to apply the multilevel theory to more than eighty phenomena, so we take a representative sampling that includes: self-concepts, self-presentation, self-esteem, self-enhancement, self-regulation, self-expansion, and self-development. Each of these has aspects that need to be understood by considering the self as a system that operates at social, individual, neural, and molecular levels.

Figure ​ Figure2 2 displays the relevant levels and their interconnections. We understand a mechanism to be a system of parts whose interactions produce regular changes ( Bechtel, 2008 ; Thagard, 2012 ). The social level consists of people who communicate with each other. The individual level consists of mental representations and computational procedures that operate on them. The neural level consists of neurons that excite and inhibit each other. Finally, the molecular level consists of genes, proteins, neurotransmitters, and hormones that affect neural operation. For defense of this account of levels of mechanisms, and the occurrence of causal links between social and molecular levels, see Thagard (2014) .

Diagram of the self as a multilevel system. Lines with arrows indicate causality. Thick lines indicate composition. Source: Thagard (2014) .

We do not mean to suggest that there are three separate selves capable of representing, effecting, and changing, any more than we implied that there are separate social, individual, neural, and molecular selves. We especially want to avoid the ridiculous suggestion that a person might consist of twelve different selves combining three different aspects at four different levels. Our goal is to display the unity of the self, not just its amazing diversity. Unification arises first from seeing the interconnections of the four levels described earlier, and second from recognizing how the interconnected mechanisms produce all three of the self’s functions.

The scientific value of understanding the self as a multilevel system depends on its fruitfulness in generating explanations of important empirical findings concerning the various self-phenomena. We will attempt to show the relevance of multiple mechanisms for understanding three phenomena that are involved in representational aspects of the self: self-concepts, self-presentation, and self-esteem. Respectively, these involve representing oneself to oneself, representing oneself to others, and evaluating oneself.

Self-Concepts (Representing Oneself to Oneself)

Self researchers distinguish between self-concept, which involves content —one’s thoughts, beliefs, and knowledge about the self—and self-esteem, which involves evaluation —evaluation of oneself as good, bad, worthy, unworthy, and so forth. Here we focus on self-concepts, considering them at individual, social, neural, and molecular levels. Psychologists studying the self no longer think of people as possessing a single, unified self-concept, but as possessing self-views in many domains ( Baumeister, 1999 ). People have various concepts that they apply to characterize themselves with respect to features such as gender, race, ethnicity, nationality, religion, occupation, hobbies, personality, and physical characteristics. For example, a man might think of himself as an intellectual, Canadian, and aging father. Moreover, not all content of those various self-views can be held in mind at once. The part of self-concept that is present in awareness at a given time has been called the “working self-concept” ( Markus and Kunda, 1986 ). What is the nature of the concepts that people apply to themselves, and what are the mechanisms underlying these applications?

The individual level of mental representations is clearly highly relevant to understanding concepts including ones about the self. What kind of mental representations are concepts? Unfortunately, there is no single currently available psychological theory of concepts that can be applied to self-concepts. Debate is ongoing about whether concepts should be understood as prototypes, collections of exemplars, or theoretical explanations ( Murphy, 2002 ; Machery, 2009 ), and all of these aspects are relevant to self-concepts ( Kunda, 1999 , Ch. 2). For example, the concept of extravert carries with it prototypical conditions such as enjoying social interactions, exemplars such as Bill Clinton, and explanations such as people going to parties because they are extraverted. Below we will suggest how all of these aspects of concepts can be integrated at the neural level.

Psychological mechanisms such as priming carried out by spreading activation between concepts explain how different concepts get applied in different situations. For example, people at parties may be especially prone to think of themselves as extraverted. Such explanations require also taking into account social mechanisms such as communication and other forms of interaction. Then the causes of applying the concept extraverted to oneself include social mechanisms as well as the individual mechanism of spreading activation among concepts.

The vast literature on self-concepts points to the interplay of the individual and social levels in a myriad of ways. First is research on social comparison, which shows that one’s working self-concept depends on the other people present ( Wood, 1989 ). Ads with skinny models can make one feel fat, and unkempt people can make one feel well-groomed. When asked to describe themselves, people tend to list characteristics that make them distinctive in their immediate social setting. A woman in a group of men is especially likely to list her gender, and a white man in a group of African–American men is especially likely to list his race (e.g., McGuire et al., 1978 ).

More permanent aspects of one’s social surround can have more consequential effects on self-concept. For example, college graduates’ career aspirations depend on their standing relative to their peers at their own college, regardless of the college’s standing relative to other institutions ( Davis, 1966 ). A student who earns high grades at institutions where grading is easier tends to have higher career aspirations than an equally qualified student at a more competitive college. This phenomenon has been called “the campus as a frog pond”; for the frog in a shallow pond aims his [or her] sights higher than an equally talented frog in a deep pond ( Pettigrew, 1967 , p. 257). According to social identity theory, one psychological basis of group discrimination is that people identify with some groups and contrast themselves with other groups that are viewed less favorably ( Tajfel, 1974 ).

Self-concepts are also influenced by the culture in which one lives. Markus and Kitayama (1991) proposed that whereas Westerners have more “independent self-construals,” in which the self is autonomous and guided by internal thoughts and feelings, Asians have more “interdependent self-construals,” in which the self is connected with others and guided, at least in part, by others’ thoughts and feelings.

Another way that the individual and social levels intersect with respect to self-concept involves the “looking-glass self” or “reflected appraisals”—the idea that people come to see themselves as others see them. This idea has been prominent in social science for some time (e.g., Mead, 1967 ), but research in social psychology in the last few decades leads to a different conclusion: People do not see very clearly how others, especially strangers, see them, and instead believe that others see them as they see themselves (see Tice and Wallace, 2003 , for a review). Instead of others’ views influencing one’s self-view, then, one’s self-view determines how one thinks others view oneself. It is possible, however, that within close relationships, the reflected self plays a greater role in shaping the self-concept ( Tice and Wallace, 2003 ).

Feedback from others can also affect self-concepts, and not just in the way one might expect. For example, although people may think of themselves as more attractive when they have been told they are attractive, people sometimes resist others’ feedback in various ways ( Swann and Schroeder, 1995 ). For example, when people with high self-esteem (HSEs) learn they have failed in one domain, they recruit positive self-conceptions in other domains (e.g., Dodgson and Wood, 1998 ). People are more likely to incorporate others’ feedback into their self-views if that feedback is close to their pre-existing self-view than if it is too discrepant ( Shrauger and Rosenberg, 1970 ).

Self-concepts also change with one’s relationships. Two longitudinal studies showed that people’s self-descriptions increased in diversity after they fell in love; people appear to adopt some of their beloved’s characteristics as their own ( Aron et al., 1995 ). Several studies also indicate that cognitive representations of one’s romantic partner become part of one’s own self-representation (as reviewed by Aron, 2003 ). Andersen and Chen (2002) describe a “relational self” in which knowledge about the self is linked with knowledge about significant others.

Interactions with other people also affect the self-concept through a process called “behavioral confirmation,” whereby people act to confirm other people’s expectations ( Darley and Fazio, 1980 ). For example, when male participants were led to believe that a woman they were speaking to over an intercom was physically attractive, that woman ended up behaving in a more appealing way than when the man thought she was unattractive ( Snyder et al., 1977 ). Presumably, a man’s expectation that a woman is attractive leads him to act especially warmly toward her, which in turn brings to the fore a working self-concept for her that is especially friendly and warm. Evidence suggests that when people believe that others will accept them, they behave warmly, which in turn leads those others to accept them; when they expect rejection, they behave coldly, which leads to less acceptance ( Stinson et al., 2009 ). More consequential results of behavioral confirmation are evident in a classic study of the “Pygmalion” effect, in which teachers were led to have high expectations for certain students (randomly determined), who then improved in academic performance ( Rosenthal and Jacobson, 1968 ).

So far we have considered social effects on the self-concept. In turn, one’s self-concept influences one’s judgments of others in many ways. In his review of this large literature, Dunning (2003) grouped such effects into three main categories. First, in the absence of information about others, people assume that others are similar to themselves. Second, in their impressions of another person, people emphasize the domains in which they themselves are strong or proficient. Third, when judging others on some dimension, such as physical fitness, people tend to use themselves as a benchmark. Given a man who takes a daily 20-min walk, athletes will judge him to be unfit, whereas couch potatoes will judge him to be highly fit.

Finally, researchers have examined not only the content of self-concepts, but their clarity. People with clearer self-concepts respond to questions about themselves more quickly, extremely, and confidently, and their self-concepts are more stable over time ( Campbell, 1990 ). Recent research has pointed to social influences on self-concept clarity. For example, clarity of self-concepts regarding particular traits depends in part on how observable those traits are to others ( Stinson et al., 2008b ). And when people with low self-esteem (LSEs) receive more social acceptance than they are accustomed to, they become less clear in their self-concepts; the same is true when people with high self-esteem encounter social rejection ( Stinson et al., 2010 ). In sum, social factors are as relevant to understanding the operation of self-concepts as are factors involving the operation of mental representations in individual minds.

Moving to the level of neural mechanisms provides a way of seeing how concepts can function in all the ways that psychologists have investigated—as prototypes, exemplars, and theories, if concepts are understood as patterns of neural activity ( Thagard, 2010 , p. 78),

Simulations with artificial neural networks enable us to see how concepts can have properties associated with sets of exemplars and prototypes. When a neural network is trained with multiple examples, it forms connections between its neurons that enable it to store the features of those examples implicitly. These same connections also enable the population of connected neurons to behave like a prototype, recognizing instances of a concept in accord with their ability to match various typical features rather than having to satisfy a strict set of conditions. Thus even simulated populations of artificial neurons much simpler than real ones in the brain can capture the exemplar and prototype aspects of concepts.

It is trickier to show how neural networks can be used in causal explanations, but current research is investigating how neural patterns can be used for explanatory purposes ( Thagard and Litt, 2008 ). Blouw et al. (forthcoming) present a detailed model of how neural populations can function as exemplars, prototypes, and rule-based explanations.

Another advantage of moving down to the neural level is that it becomes easier to apply multimodal concepts such as ones concerned with physical appearance. People who think of themselves as thin or fat, young or old, and quiet or loud, are applying to themselves representations that are not just verbal but also involve other modalities such as vision and sound. Because much is known about the neural basis of sensory systems, the neural level of analysis makes it easier to see how human concepts can involve representations tied to sensory systems, not only for objects such as cars with associated visual and auditory images, but also for kinds of people ( Barsalou, 2008 ).

Brain scanning experiments reveal important neural aspects of self-concepts. Tasks that involve reflecting on one’s own personality traits, feelings, physical attributes, attitudes, or preferences produce preferential activation in the medial prefrontal cortex ( Northoff and Bermpohl, 2004 ; Mitchell, 2009 ; Jenkins and Mitchell, 2011 ). Neural correlates of culturally different self-construals have also have been demonstrated. When East Asian participants were primed with an independent self-construal, right ventrolateral PFC (prefrontal cortex) activity was more active for their own face relative to a coworker’s face, whereas when primed with an interdependent self-construal, this region was activated for both faces ( Sui and Han, 2007 ).

Once concepts are understood partly in neural terms, the relevance of molecular mechanisms becomes evident too, because of the important role of affect and emotion in self-concepts. For most people, thinking of themselves as young and thin carries positive affect, whereas thinking of themselves as old and fat carries negative valence. When such valences are interpreted neurologically, molecular mechanisms involving neurotransmitters and hormones can be applied. For example, the pleasurable feelings associated with young, thin , and other concepts that people enjoy applying to themselves plausibly result from activity in neural regions rich in the neurotransmitter dopamine, such as the nucleus accumbens. On the negative side, negative feelings such as anxiety are associated with activity in the amygdala, whose neurons have receptors for the stress hormone cortisol as well as various neurotransmitters. Hence if we want to understand why people much prefer to apply some concepts to themselves and different concepts to others, it is helpful to consider the molecular mechanisms that underlie emotion as well as social, individual, and neural mechanisms. Of course, merely knowing about physiological correlates does not provide causal explanations, which requires mechanisms that link physiology to behavior.

Self-concepts illustrate complex interactions among multiple levels, belying oversimplified reductionist views that see causality as only emanating from lower to higher levels. For example, a social interaction such as a job interview can have the psychological effects of applications of particular concepts (e.g., nervous or competent ) to oneself. Activation of these concepts consists of instantiation of patterns of firing in neural populations, attended by increases and decreases in levels of various chemicals such as cortisol and dopamine. Changes in chemical levels can in turn lead to social changes, as when high cortisol makes a person socially awkward, producing counterproductive social interactions that then lead to self-application of negative concepts. Under such circumstances, the four levels can provide an amplifying feedback loop, from the social to the neuromolecular and back again.

Self-Presentation (Representing Oneself to Others)

The modes of self-representing discussed so far largely concern how one thinks about oneself, although some aspects of self-image and self-identity also sometimes concern how one wants others to think about oneself. Self-presentation is the central phenomenon for representing oneself to others. It has been discussed extensively by sociologists such as Goffman (1959) and by social psychologists ( Leary and Kowalski, 1990 ). We want to show that self-presentation involves multilevel interacting mechanisms.

Thirty years of research by social psychologists highlight the interplay of the individual and social levels in self-presentation ( Schlenker, 2003 ). One’s goals, at the individual level, affect the social level. People have a basic need for relatedness, for belonging to groups of people that they care about ( Baumeister and Leary, 1995 ; Deci and Ryan, 2000 ). People know that they are more likely to be accepted by others who have a positive impression of them, so it is natural that people typically want to create a favorable impression. However, people’s goals sometimes lead them to present themselves in socially undesirable ways (for references, see Schlenker, 2003 ). They may self-deprecate to lower others’ expectations, or try to appear intimidating to generate fear.

The social level also affects the individual level. One’s audience influences one’s self-presentation goals. For example, people tend to be more self-aggrandizing with strangers and more modest with friends ( Tice et al., 1995 ). Particularly striking evidence of the social level affecting the individual level comes from studies indicating that one’s self-presentation to others can influence one’s private self-concept (see Schlenker, 2003 ; Tice and Wallace, 2003 ). For example, in one study, participants who had been randomly assigned to present themselves as extraverted were more likely than those who had presented themselves as introverted to later rate themselves as extraverted, and even to behave in a more outgoing fashion, by sitting closer and talking more to others ( Fazio et al., 1981 ). Such self-concept change does not seem to occur unless one’s actions are observed by others ( Tice and Wallace, 2003 ), which again emphasizes the social level. In reviewing the self-presentation literature, Baumeister (1998 , p. 705) stated:

People use self-presentation to construct an identity for themselves. Most people have a certain ideal image of the person they would like to be. It is not enough merely to act like that person or to convince oneself that one resembles that person. Identity requires social validation.

Self-presentation is also dependent on neural mechanisms. People naturally fear not being accepted by others, and a variety of studies have found that the social pain of rejection involves some of the same brain areas as physical pain, such as the periaqueductal gray ( MacDonald and Leary, 2005 ). On the other hand, being accepted by others produces pleasure, which involves activation of brain areas such as the nucleus accumbens ( Ikemoto and Panksepp, 1999 ). Izuma et al. (2009) found that the prospect of social approval activates the ventral striatum, which includes the nucleus accumbens. Of course, these neural processes are also molecular ones, with dopamine and opioids associated with positive social experiences, and stress hormones like cortisol associated with negative ones. For example, when people have to give a public speech, often a painful instance of self-presentation, their cortisol levels increase, which may even produce behaviors that undermine the effectiveness of their attempts to produce a good impression ( Al’Absi et al., 1997 ).

Another substance at the molecular level that is likely to be involved in self-presentation is oxytocin, a neuropeptide that has been linked to various social behaviors (e.g., Carter, 1998 ). Oxytocin is implicated when successful self-presentation requires accurately “reading” other people to understand what would impress or please them, because oxytocin has been linked with social recognition ( Kavaliers and Choleris, 2011 ), empathic accuracy ( Rodrigues et al., 2009 ; Bartz et al., 2010 ), the processing of positive social cues ( Unkelbach et al., 2008 ), and discerning whether others are trustworthy and should be approached or not ( Mikolajczak et al., 2010 ). Thus, self-presentation involves the complex interaction of social, individual, neural, and molecular mechanisms.

Self-Esteem (Evaluating Oneself)

The third major kind of self-representing is self-evaluation, which can involve processes such as self-appraisal and self-monitoring, and result in products that range from self-love to self-loathing. We discuss self-esteem as a sample product.

Self-esteem refers to one’s overall evaluation of and liking for oneself. People differ from each other in their characteristic levels of self-esteem, which remain quite stable over time, yet people also fluctuate in their self-esteem around their own average levels. “State self-esteem” refers to one’s feelings about oneself at the moment. Measures of explicit self-esteem obtained by surveys may differ from measures of implicit self-esteem, which are thought to be based associations that are unconscious, or at least less cognitively accessible ( Zeigler-Hill and Jordan, 2011 ).

At the individual level, self-esteem involves the application of self-concepts with positive or negative emotional valence, for example thinking of oneself as a success or failure in important pursuits such as love, work, and play. When people focus on positive aspects of themselves, their state self-esteem increases (e.g., McGuire and McGuire, 1996 ).

Considerable evidence indicates that social experiences are central to both trait and state self-esteem. According to attachment theory, people begin to learn about their self-worth as infants, in their interactions with caregivers. If the caregiver is loving and responsive to the infant’s needs, the infant develops a model of the self that is worthy of love and responsiveness. If not, the child will develop negative self-models and be anxious in relationships (e.g., Holmes et al., 2005 ). We have already discussed how social comparisons can influence one’s self-concept; comparisons with other people also can boost or deflate one’s self-esteem ( Wood, 1989 ).

Social acceptance may be the chief determinant of self-esteem. Leary’s sociometer theory proposed that the very existence of self-esteem is due to the need to monitor the degree to which one is accepted and included by other people ( Leary and Baumeister, 2000 ). Indeed, the more people feel included by other people in general, as well as accepted and loved by specific people in their lives, the higher their trait self-esteem ( Leary and Baumeister, 2000 ). Numerous experimental studies indicate that rejection leads to drops in state self-esteem (e.g., Wood et al., 2009a ). Interpersonal stressors in the everyday lives of university students are associated with declines in state self-esteem ( Stinson et al., 2008a ). In contrast, being in a long-term relationship with a loving partner can raise the self-esteem of people with low self-esteem ( Murray et al., 1996 ).

The connection between the individual and social levels of self is also evident in research on how individuals’ self-esteem-related goals influence their social lives. A vast social psychological literature reveals that motivations to maintain, protect, or improve self-esteem can, for example, guide how people present themselves to others (e.g., Baumeister et al., 1989 ), lead people to compare themselves with others who are less fortunate so as to boost their own spirits ( Wood et al., 1985 ), and lead them to stereotype other people in order to feel better about themselves ( Fein and Spencer, 1997 ; Sinclair and Kunda, 2000 ).

We have repeatedly described the neural and molecular underpinnings of self-representations involving emotions, and the account of self-concepts as patterns of neural activity associated with particular kinds of neurochemical activity applies directly to self-esteem. Self-esteem is connected with depression, which has been examined at the neural level. Depression and self-esteem are substantially inversely correlated (e.g., with r s reaching –0.60 and –0.70 s; Watson et al., 2002 ); low self-esteem is even one of the symptoms of depression. Depression is well known to have neurotransmitter correlates and to be associated with brain changes.

Evidence is mounting that social acceptance and rejection are accompanied by changes at the neural level (e.g., Eisenberger et al., 2003 , 2007 ; Way et al., 2009 ). For example, in one study, participants underwent functional magnetic resonance imaging (fMRI) while they viewed words (e.g., boring, interesting) that they believed to be feedback from another person. The rejection-induced drops in self-esteem that we described earlier were accompanied by greater activity in rejection-related neural regions (dorsal ACC, anterior insula; Eisenberger et al., 2011 ). Neuroimaging studies suggest that the social pain caused by rejection involve the same brain areas as does physical pain (namely, dorsal ACC activity), whereas signs of social acceptance have been associated with subgenual ACC activity ( Somerville et al., 2006 ), and ventral striatum activity ( Izuma et al., 2008 ), neural regions associated with reward (see Lieberman, 2010 ).

Social threats not only lead to changes in the neural level, but also elicit a host of physiological responses, which point to the links between the social and molecular level. Dickerson et al. (2011) reviewed evidence of cardiovascular (e.g., blood pressure, heart rate), neuroendocrine (e.g., cortisol reactivity), and immune (e.g., inflammatory activity) changes, as well as ways in which social threats “influence the regulation of these systems” (p. 799).

Connections between the social level (rejection and acceptance by others) and the neural level (anterior cingulate and medial prefrontal cortex) have also been associated with the individual level (self-esteem). People who were low in self-esteem differed in their neural responses from those high in self-esteem when others evaluated them ( Somerville et al., 2010 ) or others excluded them ( Onoda et al., 2010 ).

Similarly, individual differences in traits that have been associated with trait self-esteem, rejection sensitivity and attachment styles, have also been linked with differences in neural responses to rejection. Burklund et al. (2007) found that rejection-sensitive people had increased dorsal anterior cingulate activity in response to disapproving facial expressions. Zayas et al. (2009) found that women who differed in attachment styles (which are associated with self-esteem) differed in their neural responses to partner rejection, as reflected in event-related potentials. There is some evidence that the causes of low self-esteem may be genetic as well as social ( Roy et al., 1995 ; Neiss et al., 2002 ), which provides another reason for moving down to the molecular level in order to consider how genes affecting neural processing might be involved in self-esteem. The operation of the molecular level also may underlie self-esteem differences in responses to stress. Taylor et al. (2003) found that people who had positive self-appraisals had lower cardiovascular responses to stress, more rapid cardiovascular recovery, and lower baseline cortisol levels than people with negative self-appraisals. Furthermore, additional research by Taylor et al. (2008) links these findings with the neural level. Participants with greater psychosocial resources, including higher self-esteem along with other characteristics such as optimism and extraversion, exhibited lower amygdala activity during threat regulation, which appeared to account for their lower cortisol reactivity ( Taylor et al., 2008 ). These psychosocial resources appear to be linked with the oxytocin receptor gene ( Saphire-Bernstein et al., 2011 ).

The interplay of three levels—social, individual, and molecular—is suggested by research by Stinson et al. (2008a) . Two studies of university students yielded evidence consistent with their prediction that low self-esteem (individual level) led to interpersonal problems (social level), which in turn resulted in health problems (e.g., missed classes due to illness and visits to the physician). Health problems indicate changes at the molecular level as they imply physiological changes. Dickerson et al. (2011) have made a compelling case that the physiological responses brought about by social threats can worsen physical health.

Considering self-esteem at the neural and molecular levels may provide explanations for why self-esteem in some individuals is less influenced by life experience than learning theories would explain. For example, not all successful people have high self-esteem (e.g., Baumeister et al., 2003a ), and it is possible that the exceptions may arise from underlying neural and molecular differences that the individual level does not capture.

In addition to the dozens of self-phenomena concerned with self-representation, there are many phenomena concerned with the self attempting to modify its own states and behavior. These self-effecting phenomena fall into two groups, self-facilitating cases in which one attempts to foster positive aspects of oneself, and self-limiting cases in which one attempts to prevent the behavioral expression of negative aspects of oneself. We will discuss self-enhancement as an important kind of self-facilitation, and self-regulation as an important kind of self-limitation.

Self-Enhancement

Self-enhancement, the motive to develop and maintain a positive self-view, has been a dominant topic in the social psychological literature for decades. Self-enhancement has been seen as a motivation guiding much of human behavior, with some researchers concluding that it is the paramount self-related motive, overriding other goals such as self-accuracy and self-consistency (e.g., Baumeister, 1998 ; but see Kwang and Swann, 2010 ). However, a wealth of self-verification studies have provided compelling evidence that people also want to confirm their self-views and to get others to see them as they see themselves ( Swann, 2012 ). Hence self-verification can sometimes be self-limiting and sometimes self-facilitating.

Research has identified many strategies of self-enhancement. To cope with failure, for example, people may attribute the failure externally (e.g., say the test is unfair), minimize the failure, focus on other positive aspects of themselves, derogate other people, or make downward comparisons—that is, compare themselves with others who are inferior (e.g., Blaine and Crocker, 1993 ; Dodgson and Wood, 1998 ). Over and over again, research has found that the people who engage in such self-enhancement strategies are dispositionally high in self-esteem, rather than low in self-esteem (e.g., Blaine and Crocker, 1993 ). This self-esteem difference may occur because people with high self-esteem are more motivated than people with low self-esteem to repair unhappy moods ( Heimpel et al., 2002 ); or because HSEs are more motivated than LSEs to feel good about themselves (e.g., Baumeister et al., 1989 ); or because LSEs are equally motivated to self-enhance, but cannot as readily claim or defend a positive view of themselves (e.g., Blaine and Crocker, 1993 ).

One self-enhancement strategy deserves mention because it is a mainstay of self-help books and the popular press: positive self-statements. People facing a stressor, cancer patients, and people chronically low in self-esteem are encouraged to say to themselves such things as, “I am a beautiful person” and “I can do this!” Despite the popularity of positive self-statements and the widespread assumption that they work, their effectiveness was not subjected to scientific scrutiny until recently. Wood et al. (2009b) found that repeating the statement, “I am a lovable person” improved people’s moods only for those who already had high self-esteem. For people with low self-esteem, the statement actually backfired, worsening their moods and their feelings about themselves.

A strikingly different self-enhancement strategy is “self-affirmation” ( Steele, 1988 ). As studied by social psychologists, self-affirmation does not refer to saying positive things to oneself, but to much more subtle methods involving the expression of one’s values. Self-affirmation strategies have included writing a paragraph concerning a value one cherishes (e.g., politics, social connections), or even merely completing a scale highlighting such values. Such strategies seem to be self-enhancing in that they reduce defensiveness (e.g., Crocker et al., 2008 ), reduce stereotyping ( Fein and Spencer, 1997 ), make people more open to self-evaluation ( Spencer et al., 2001 ), and can substitute for other methods of self-enhancement (e.g., Wood et al., 1999 ).

Although self-enhancement may seem to be a private matter, operating at the individual level, the social level is clearly influential. Most threats to self-esteem arise in social contexts when feedback from others or others’ behavior leads people to doubt their preferred view of themselves, or to feel devalued or rejected. Hence self-enhancement results from the process of self-evaluation, whose social causes and context we have already discussed. In addition, self-enhancement processes may enlist the social level. Some of the self-enhancement strategies identified above, such as downward comparisons and derogating other people, involve using the social realm to boost oneself at the individual level. Another example comes from research on the triggers of stereotyping. Fein and Spencer (1997) showed that after they fail, people were especially likely to seize on a stereotype of Jewish women. Similarly, after receiving negative feedback, people derogated the person who delivered the feedback, if that person was a woman rather than a man ( Sinclair and Kunda, 2000 ). Other social strategies of self-enhancement can include being boastful and overconfident (e.g., Colvin et al., 1995 ), helping others (e.g., Brown and Smart, 1991 ), and aggressing against others ( Twenge and Campbell, 2003 ). People may also enhance themselves through their group memberships and social identities ( Banaji and Prentice, 1994 ). Self-enhancement research, then, reveals links between the individual and social levels of self because the social world often elicits the need for self-enhancement, and certain self-enhancement strategies involve the interpersonal realm. In addition, because self-enhancement can encourage or diminish stereotyping, aggression, and prosocial behavior, self-enhancement clearly has many potential social consequences.

That self-enhancement also operates at the molecular level is shown by a study of self-affirmation. Participants who engaged in a values-affirmation task before they faced a stressor had lower cortisol responses to stress than did participants who had not engaged in values-affirmation ( Creswell et al., 2005 ).

Self-enhancement also operates at the neural level as it involves applications of concepts such as loveable which, as we argued earlier, can be understood as patterns of activation in populations of neurons. The study by Wood et al. (2009a) showed that self-statements can alter positive and negative moods, which plausibly involves alteration of activities of neurotransmitters such as dopamine. Better understanding of the neural and genetic determinants of low self-esteem could provide the basis for explaining why positive self-statements can have negative effects on people with low self-esteem.

Self-Regulation

Although self researchers were long preoccupied with the topics of self-concept and self-esteem, they have come to appreciate that “self-regulation is one of the most important functions of the self” ( Gailliot et al., 2008 , p. 474). Self-regulation concerns how people pursue their goals or try to control their own behavior, thoughts, or feelings. An idea discussed earlier in the section on self-evaluation—that people continually compare themselves with standards—is central to many theories of self-regulation (e.g., Carver and Scheier, 1990 ). Such theories posit that when people experience a discrepancy between a standard and their own standing (behavior, thoughts, or feelings) on the relevant dimension, they deliberately or even automatically attempt to reduce that discrepancy, in one of three ways. They can try to adjust their behavior (or thoughts or feelings) so that it meets the standard, change their standards, or exit the situation. Self-regulation is successful when the discrepancy is eliminated or reduced (e.g., Carver and Scheier, 1990 ).

The biological aspects of the self are most obvious in the self-limiting phenomena aimed at controlling or managing excessive desires for food, alcohol, drugs, sex, or inactivity. Such desires are all rooted in neural and molecular mechanisms that must be counteracted in order to overcome self-destructive behaviors such as overeating. We will not attempt a comprehensive account of all the phenomena concerned with limiting the self, but discuss three main foci of self-regulation research in recent years: goal pursuit, emotion regulation, and ego-depletion—how exercising self-control in one domain diminishes one’s capacity to do so in a second domain.

Research on social comparison establishes a basic connection between the individual and social levels. To meet such goals as self-evaluation, self-improvement, and self-enhancement, individuals compare themselves with other people ( Wood, 1989 ). In this case, other people serve as the standards for meeting one’s goal progress.

Other people can even influence which goals we adopt. Fitzsimons and her colleagues have found that observing a stranger’s goal-directed behavior can lead people to pursue the same goals themselves, or to synchronize their goal pursuits with others, with interesting consequences. For example, people who observe others fail work harder, and people who observe others succeed take it easy ( McCullough et al., 2010 ). Even being in the presence of someone who was a stranger a few minutes before, but who shares similarities such as tastes in movies, can lead one to adopt the other’s goals as one’s own ( Walton et al., 2012 ). Such effects can even occur subconsciously. For example, when participants who had a goal to achieve to please their mother were primed with their mother, they outperformed control participants on an achievement task ( Fitzsimons and Bargh, 2003 ).

One’s own goals also affect one’s relationships with others. People draw closer to others who are instrumental in helping them to progress toward their goals, and distance themselves from others who do not promote such progress ( Fitzsimons and Shah, 2008 ). People seem to cultivate a social environment for themselves that promotes their goals, especially when their progress toward their goals is poor ( Fitzsimons and Fishbach, 2010 ).

Regulation of emotions is an important topic in clinical, social, and cross-cultural psychology ( Vandekerckhove et al., 2008 ). Research on emotion regulation—which concerns how people try to manage their emotional states—has amply demonstrated the interplay between the individual and social levels. For example, people try to adjust their moods in preparation for an upcoming social interaction, according to the social requirements expected ( Erber and Erber, 2000 ). In addition, social events affect one’s emotion regulation: Rejection experiences appear to lead people with low self-esteem to feel less deserving of a good mood, which in turn dampens their motivation to improve a sad mood ( Wood et al., 2009a ).

A specific example of emotion regulation, anger management, shows the need for multilevel explanations. The strategies for anger management recommended by the American Psychological Association ( APA, 2012 ) operate at all four levels: social, individual, neural, and molecular. Social strategies including expressing concerns with a sympathetic person and moderately communicating with the sources of anger. Humor involving pleasant social interactions can be a potent way of defusing anger. Temporary or permanent removal from anger-provoking social environments can also be helpful.

Psychological strategies for managing anger include the revisions of beliefs, goals, and attitudes. Cognitive therapy aims to help people by changing dysfunctional thinking, behavior, and emotion. Dysfunctional aspects of anger can be addressed by examining whether the beliefs and goals that underlie angry reactions are inaccurate and modifiable. According to the theory of emotions as cognitive appraisals, anger is a judgment that someone or something is thwarting one’s goals, so that anger should be reduced by realization either that the goals are not so important or by revision of beliefs about whatever is thought to be responsible for goal blocking.

Emotions such as anger, however, are not merely cognitive judgments, but also simultaneously involve brain perception of physiological states ( Thagard, 2006 ; Thagard and Aubie, 2008 ). Hence it is not surprising that anger management techniques include various methods for reducing physiological arousal, such as exercise and relaxation through deep breathing, mediation, and muscle tensing and release. Reducing physiological arousal reduces perception of body states performed by the insula and other brain areas, thereby reducing the overall brain activity that constitutes anger. Similarly, when oxytocin is administered to couples discussing a conflict, their positive verbal and non-verbal behaviors increase ( Ditzen et al., 2009 ).

In severe cases of anger, pharmaceutical treatments may be useful, including anti-depressants such as Prozac that affect the neurotransmitter serotonin, anti-anxiety drugs that affect the neurotransmitter GABA (gamma-Aminobutyric acid), and sometimes even anti-psychotics that affect various other neurotransmitters. The onset of anger can also be exacerbated by recreational use of drugs such as alcohol whose effects on brain chemistry are well known. Hence anger management is an aspect of self-regulation that operates at the molecular level as well as the higher ones.

Ego-depletion studies demonstrate that when people override their emotions, thoughts, impulses, or automatic or habitual behaviors, they have trouble doing so a second time ( Baumeister et al., 2007 ). For example, in one study, research participants had to resist freshly-baked chocolate-chip cookies; they were allowed to eat only radishes instead. When they then faced an impossible puzzle, they gave up more rapidly than participants who had not been required to resist the tempting cookies ( Baumeister et al., 1998 ). In another study, participants who were asked to suppress certain thoughts subsequently had more trouble resisting free beer than did control participants, even when they expected to take a driving test ( Muraven et al., 2002 ).

Ego-depletion research has shown connections between the individual and social levels in two ways. First, difficult social interactions can deplete one’s self-regulatory resources ( Vohs et al., 2005 ). Interracial interactions, for example, can be taxing if one tries not to appear prejudiced. Richeson and Shelton (2003) found that after prejudiced white participants interacted with a black participant, they performed more poorly on a cognitive control task, compared to participants who interacted with a white participant or participants scoring low in prejudice. Social interactions also can be depleting if one is required to engage in atypical self-presentation, such as being boastful to strangers ( Vohs et al., 2005 ). And in yet another example of the harmful consequences of social rejection, studies have indicated that it too can impair self-regulation (see Gailliot et al., 2008 , for references).

Second, ego-depletion makes it difficult to navigate social interactions. Participants who had engaged in previous acts of unrelated effortful self-regulation later were more egotistical in their self-descriptions and less able to choose topics for discussion with a stranger that were appropriate in their level of intimacy ( Vohs et al., 2005 ). Self-regulatory depletion also may encourage sexual infidelity and acts of discrimination ( Gailliot et al., 2008 ). Successful self-regulation, then, may smooth one’s interpersonal interactions and make one’s close relationships more harmonious. It is unclear, however, whether ego-depletion is the result of fundamental neural mechanisms of will, or rather individual mechanisms of self-representation: Job et al. (2010) report studies that support the view that reduced self-control after a depleting task or during demanding periods may reflect people’s beliefs about the availability of willpower rather than true resource depletion.

People who have sustained damage to the prefrontal cortex exhibit various self-regulatory deficits, such as impulsivity and poor judgment (see Gailliot et al., 2008 , for references). The anterior cingulate is involved in tasks that deplete self-regulatory resources via the coordination of divided attention, and the dorsolateral prefrontal cortex affects the activation, maintenance, and modification of goal-directed responses ( Baumeister et al., 2003b ). Attempts at self-control recruit a network of brain regions including the lateral and posterior dorsomedial prefrontal cortex ( MacDonald et al., 2000 ). The consensus across thirty neuroimaging studies of emotion regulation in particular is that right ventrolateral PFC and left ventrolateral PFC activity are involved. Other areas also are implicated, including the presupplementary motor area, the posterior dorsomedial PFC, left dorsolateral PFC, and rostral ACC, and their involvement appears to depend on whether the emotion regulation is intentional or incidental to the participants’ task (see Lieberman, 2010 , for a review).

Research by Richeson et al. (2003) elegantly links the neural, individual, and social levels of self-regulation. They found that for White participants who held especially negative unconscious attitudes toward Blacks, interacting with a Black person led them to perform poorly on a subsequent self-regulatory task. This effect was mediated by the extent to which these White participants’ dorsolateral prefrontal cortex was activated while they viewed Black faces (in a separate session).

Molecular mechanisms are also undoubtedly involved in self-regulation, although few have been identified. Blood glucose has been thought to underlie ego-depletion phenomena ( Gailliot et al., 2008 ), but recent evidence has challenged that idea (e.g., Molden et al., 2012 ). Oxytocin may well promote self-regulation in the interpersonal sphere. It appears to lead mothers to tend to their offspring ( Taylor, 2002 ; Feldman et al., 2007 ), lead people in general to seek and provide social support in stressful circumstances ( Taylor, 2002 ), and to promote helping behavior ( Brown and Brown, 2006 ).

In sum, self-effecting phenomena such as self-enhancement and self-regulation are best understood at multiple mechanistic levels.

Self-effecting phenomena involve local changes and behavior, but there is a final group of phenomena that involve more permanent changes to the self ( Brinthaupt and Lipka, 1994 ). We cover two change phenomena: self-expansion and self-development.

Self-Expansion

According to Aron’s self-expansion theory, human beings have a central desire to expand the self—to acquire resources, perspectives, and identities that enhance their ability to accomplish goals. Self expansion is a motivation to enhance potential efficacy ( Aron et al., 2004 , p. 105).

This motivation to self-expand at the individual level influences the social level: Aron et al. (2004) argue that self-expansion motives lead people to enter and maintain close relationships with others. In close relationships, each partner includes the other in the self, meaning that each takes on the other’s resources, perspectives, and identities to some extent. Evidence for such processes is illustrated by findings of a study by Aron et al. (1995) , who asked university students to respond to the open-ended question “Who are you today?” every 2 weeks for 10 weeks. When respondents had fallen in love during the preceding 2 weeks, their answers to this question revealed increases in the diversity of their self-concept, compared to periods when they had not fallen in love and compared to other respondents who had not fallen in love. They also showed increased self-efficacy and self-esteem. These results remained significant even after mood changes were controlled statistically.

Falling in love also seems to be accompanied by changes in the brain. fMRI studies show that when people who have recently fallen intensely in love look at a photo of or think about their beloved, they have increased activity in the caudate nucleus, which is a central part of the brain’s reward system, as well as in the right ventral tegmental area, a region associated with the production and distribution of dopamine to other brain regions ( Aron et al., 2005 ). Even subliminal priming with a beloved’s name has similar effects ( Ortigue et al., 2007 ). These results suggest that passionate romantic love is associated with dopamine pathways in the reward system of the brain. These dopaminergic pathways are rich in oxytocin receptors ( Bartels and Zeki, 2004 ; Fisher et al., 2006 ). When women talk about a love experience, oxytocin release is associated with the extent to which they display affiliation cues such as smiles and head nods ( Gonzaga et al., 2006 ).

Recent research offers exciting evidence of possible brain changes with self-expansion. Ortigue and Bianchi-Demicheli (2010) found that when people were primed with their romantic partner’s name (and not a friend’s), they showed more intense activation of the left angular gyrus, the same region that is activated when people think of themselves.

Self-Development

Self-development refers to the changes that people naturally undergo over the course of their lives. Major developmental periods include early years when infants and toddlers begin to acquire identities ( Bloom, 2004 ; Rochat, 2009 ), adolescence when teenagers establish increasing independence from parents ( Sylwester, 2007 ), and old age when physical decline imposes new limitations on the self. Each of these periods involves extensive social, individual, neural, and molecular changes, but we will focus on old age, drawing on Breytspraak (1984) and Johnson (2005) .

Social relations and the aspects of the self dependent on them change dramatically as people get older. Major changes can include the completion of child-rearing, retirement from employment, diminishing social contacts resulting from physical disabilities, and loss of friends and family to death or infirmity. These changes can all affect the quantity and quality of social interactions that are causally associated with a person’s behaviors and representations.

At the individual level, there are changes in processes, representations, and emotions. Cognitive functioning measured by processing speed and short-term memory capability declines steadily from people’s thirties, and more precipitously in their sixties and later ( Salthouse, 2004 ). Self-conceptions may be stable in some respects, but often alter in others, as people define themselves increasingly in terms of health and physical functioning rather than work roles. People in early stages of old age tend to be happier than those in middle age, but infirmities can bring substantial difficulties ( Stone et al., 2010 ).

Neural causes of changes in the self are most evident in extreme cases like Alzheimer’s disease, when brain degeneration progressively eliminates anything but a minimal sense of self. There are also age-related disorders such as fronto-temporal dementia that can drastically diminish self-effecting phenomena such as self-control ( Eslinger et al., 2005 ). Aging also brings about molecular changes, for example in reduction of levels of hormones such as testosterone and estrogen that affect neural processing. Hence for a combination of social, individual, neural, and molecular reasons, self-development takes on important directions in old age. Similar observations could be made about other crucial stages of personal development such as adolescence. The changing self, like the representing and effecting self, operates through multilevel interacting mechanisms.

We have shown the relevance of social, individual, neural, and molecular levels to seven important phenomena: self-concepts, self-presentation, self-esteem, self-enhancement, self-regulation, self-expansion, and self-development. These seven are representative of three general classes (self-representing, self-effecting, and self-changing) that cover more than eighty self-phenomena important in psychological discussions of the self.

A full theory of the self will need to specify much more about the nature of the mechanisms at each level, and equally importantly, will need to specify much more about the relations between the levels. Thagard (2014) argued against the common reductionist assumption that causation runs only upward from molecular to neural to individual to social mechanisms. A social interaction such as one person complimenting another has effects on individuals’ mental representations, on neural firing, and on molecular processes such as ones involving dopamine and oxytocin. Fuller explanation of the more than eighty self-phenomena that we have classified in this paper will require elucidation of how they each result from multilevel interactions.

Explanations of complex systems often identify emergent properties, which belong to wholes but not to their parts because they result from the interactions of their parts ( Findlay and Thagard, 2012 ). This basic idea of emergence concerns only the connections of two levels, where the properties of wholes at the higher level (e.g., consciousness) emerge from interactions of parts at the lower levels (neurons). Thinking of the self as resulting from multiple interacting mechanisms points to a more complicated kind of emergence that has gone unrecognized. Multilevel emergence occurs when the property of a whole such as the self results from interactions in mechanisms at several different levels, in this case molecular and social as well as neural and cognitive. What you are as a self depends on your genes and your social influences as well as on your semantic pointers and mental representations. Major changes in the self such as religious conversions, dramatic career shifts, and recovery from mental illness are critical transitions that result from interactions among multiple levels. For example, recovery from severe depression often requires (1) changes in neurotransmitters through medication operating at the molecular and neural levels and (2) changes in beliefs and goals through psychotherapy operating at the mental and social levels. Future theoretical work on the self will benefit from more detailed accounts of the interactions of individual, social, neural, and molecular mechanisms.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

• Al’Absi M., Bongard S., Buchanan T., Pincomb G. A., Licinio J., Lovallo W. R. (1997). Cardiovascular and neuroendocrine adjustment to public speaking and mental arithmetic stressors . Psychophysiology 34 , 266–275. 10.1111/j.1469-8986.1997.tb02397.x [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Alicke M. D., Dunning D. A., Krueger J. I. (2005). The Self in Social Judgment . New York, NY: Psychology Press. [ Google Scholar ]
• Andersen S. M., Chen S. (2002). The relational self: an interpersonal social-cognitive theory . Psychol. Rev. 109 , 619–645. 10.1037/0033-295X.109.4.619 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• APA. (2012). Controlling Anger Before it Controls You Available at: http://www.apa.org/topics/anger/control.aspx [accessed March 18, 2015].
• Aron A. (2003). “Self and close relationships,” in Handbook of Self and Identity , eds Leary M. R., Tangney J. P. (New York, NY: Guilford Press; ), 442–461. [ Google Scholar ]
• Aron A., Fisher H., Mashek D. J., Strong G., Li H., Brown L. L. (2005). Reward, motivation, and emotion systems associated with early-stage intense romantic love . J. Neurophysiol. 94 , 327–337. 10.1152/jn.00838.2004 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Aron A., McLaughlin-Volpe T., Mashek D., Lewandowski G., Wright S. C., Aron E. N. (2004). Including others in the self . Eur. Rev. Soc. Psychol. 15 , 101–132 10.1080/10463280440000008 [ CrossRef ] [ Google Scholar ]
• Aron A., Paris M., Aron E. N. (1995). Falling in love: prospective studies of self-concept change . J. Pers. Soc. Psychol. 69 , 1102–1112 10.1037/0022-3514.69.6.1102 [ CrossRef ] [ Google Scholar ]
• Banaji M. R., Prentice D. A. (1994). The self in social contexts . Annu. Rev. Psychol. 45 , 297–332 10.1146/annurev.ps.45.020194.001501 [ CrossRef ] [ Google Scholar ]
• Barsalou L. W. (2008). Grounded cognition . Annu. Rev. Psychol. 59 , 617–645. 10.1146/annurev.psych.59.103006.093639 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Bartels A., Zeki S. (2004). The neural correlates of maternal and romantic love . Neuroimage 21 , 1155–1166. 10.1016/j.neuroimage.2003.11.003 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Bartz J. A., Zaki J., Bolger N., Hollander E., Ludwig N. N., Kolevzon A., et al. (2010). Oxytocin selectively improves empathic accuracy . Psychol. Sci. 21 , 1426–1428. 10.1177/0956797610383439 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Baumeister R. (1999). The Self in Social Psychology . Philadelphia, PA: Psychology Press. [ Google Scholar ]
• Baumeister R. F. (1998). “The self,” in The Handbook of Social Psychology , Vols. 1 and 2 , 4th Edn, eds Gilbert D. T., Fiske S. T., Lindzey G. (New York, NY: McGraw-Hill; ), 680–740. [ Google Scholar ]
• Baumeister R. F., Bratslavsky E., Muraven M., Tice D. M. (1998). Ego depletion: is the active self a limited resource? J. Pers. Soc. Psychol. 74 , 1252–1265. 10.1037/0022-3514.74.5.1252 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Baumeister R. F., Campbell J. D., Krueger J. I., Vohs K. D. (2003a). Does high self-esteem cause better performance, interpersonal success, happiness, or healthier lifestyles? Psychol. Sci. Public Interest 4 , 1–44 10.1111/1529-1006.01431 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Baumeister R. F., Vohs K. D., Leary M. R., Tangney J. P. (2003b). Self-Regulation and the Executive Function of the Self Handbook of Self and Identity . New York, NY: Guilford Press, 197–217. [ Google Scholar ]
• Baumeister R. F., Leary M. R. (1995). The need to belong: desire for interpersonal attachments as a fundamental human motivation . Psychol. Bull. 117 , 497–529. 10.1037/0033-2909.117.3.497 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Baumeister R. F., Tice D. M., Hutton D. G. (1989). Self-presentational motivations and personality differences in self-esteem . J. Pers. 57 , 547–579 10.1111/j.1467-6494.1989.tb02384.x [ CrossRef ] [ Google Scholar ]
• Baumeister R. F., Vohs K. D., Tice D. M. (2007). The strength model of self-control . Curr. Dir. Psychol. Sci. 16 , 351–355 10.1111/j.1467-8721.2007.00534.x [ CrossRef ] [ Google Scholar ]
• Bechtel W. (2008). Mental Mechanisms: Philosophical Perspectives on Cognitive Neuroscience . New York, NY: Routledge. [ Google Scholar ]
• Blaine B., Crocker J. (1993). “Self-esteem and self-serving biases in reactions to positive and negative events: an integrative review,” in Self-Esteem: The Puzzle of Low Self-Regard , ed. Baumeister R. F. (New York, NY: Plenum; ), 55–86. [ Google Scholar ]
• Bloom P. (2004). Descartes’ Baby . New York, NY: Basic Books. [ Google Scholar ]
• Blouw P., Solodkin E., Thagard P., Eliasmith C. (forthcoming). Concepts as semantic pointers: a theory and computational model. Cogn. Sci. [ PubMed ]
• Breytspraak L. M. (1984). The Development of Self in Later Life . Boston, MA: Little, Brown. [ Google Scholar ]
• Brinthaupt T. M., Lipka R. P. (1994). Changing the Self: Philosophies, Techniques, and Experiences . Albany, NY: State University of New York Press. [ Google Scholar ]
• Brown J. D., Smart S. A. (1991). The self and social conduct: linking self-representations to prosocial behavior . J. Pers. Soc. Psychol. 60 , 368–375 10.1037/0022-3514.60.3.368 [ CrossRef ] [ Google Scholar ]
• Brown S. L., Brown R. M. (2006). Selective investment theory: recasting the functional significance of social relationships . Psychol. Inq. 17 , 1–29 10.1207/s15327965pli1701_01 [ CrossRef ] [ Google Scholar ]
• Burklund L. J., Eisenberger N. I., Lieberman M. D. (2007). The face of rejection: rejection sensitivity moderates dorsal anterior cingulated activity to disapproving facial expressions . Soc. Neurosci. 2 , 238–253. 10.1080/17470910701391711 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Campbell J. D. (1990). Self-esteem and clarity of the self-concept . J. Pers. Soc. Psychol. 59 , 538–549. 10.1037/0022-3514.59.3.538 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Carter C. S. (1998). Neuroendocrine perspectives on social attachment and love . Psychoneuroendocrinology 23 , 770–818. [ PubMed ] [ Google Scholar ]
• Carver C. S., Scheier M. F. (1990). Origins and functions of positive and negative affect: a control-process view . Psychol. Rev. 97 , 19–35 10.1037/0033-295X.97.1.19 [ CrossRef ] [ Google Scholar ]
• Colvin C. R., Block J., Funder D. C. (1995). Overly positive self-evaluations and personality: negative implications for mental health . J. Pers. Soc. Psychol. 68 , 1152–1162. 10.1037/0022-3514.68.6.1152 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Creswell J. D., Welch W. T., Taylor S. E., Sherman D. K., Gruenewald T. L., Mann T. (2005). Affirmation of personal values buffers neuroendocrine and psychological stress responses . Psychol. Sci. 16 , 846–851. 10.1111/j.1467-9280.2005.01624.x [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Crocker J., Niiya Y., Mischkowski D. (2008). Why does writing about important values reduce defensiveness? Self-affirmation and the role of positive other-directed feelings . Psychol. Sci. 19 , 740–747. 10.1111/j.1467-9280.2008.02150.x [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Darley J. M., Fazio R. H. (1980). Expectancy confirmation processes arising in the social interaction sequence . Am. Psychol. 35 , 867–881 10.1037/0003-066X.35.10.867 [ CrossRef ] [ Google Scholar ]
• Davis J. A. (1966). The campus as a frog pond: an application of the theory of relative deprivation to career decisions of college men . Am. J. Soc. 72 , 17–31 10.1086/224257 [ CrossRef ] [ Google Scholar ]
• Deci E. L., Ryan R. M. (2000). The “what” and “why” of goal pursuits: human needs and the self-determination of behavior . Psychol. Inq. 11 , 227–268 10.1207/S15327965PLI1104_01 [ CrossRef ] [ Google Scholar ]
• Dickerson S. S., Gruenewald T. L., Kemeny M. E. (2011). “Physiological effects of social threat: implications for health,” in Handbook of Social Neuroscience , eds Cacioppo J., Decety J. (New York, NY: Oxford University Press; ), 787–803. [ Google Scholar ]
• Ditzen B., Schaer M., Gabriel B., Bodenmann G., Ehlert U., Heinrichs M. (2009). Intranasal oxytocin increases positive communication and reduces cortisol levels during couple conflict . Biol. Psychiatry 65 , 728–731. 10.1016/j.biopsych.2008.10.011 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Dodgson P. G., Wood J. V. (1998). Self-esteem and the cognitive accessibility of strengths and weaknesses after failure . J. Pers. Soc. Psychol. 75 , 178–197. 10.1037/0022-3514.75.1.178 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Dunning D. (2003). “The relation of self to social perception,” in Handbook of Self and Identity , eds Leary M. R., Tangney J. P. (New York, NY: Guilford Press; ), 421–441. [ Google Scholar ]
• Eisenberger N. I., Gable S. L., Lieberman M. D. (2007). fMRI responses relate to differences in real-world social experience . Emotion 7 , 745–754. 10.1037/1528-3542.7.4.745 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Eisenberger N. I., Inagaki T. K., Muscatell K. A., Byrne Haltom K. E., Leary M. R. (2011). The neural sociometer: brain mechanisms underlying state self-esteem . J. Cogn. Neurosci. 23 , 3448–3455. 10.1162/jocn_a_00027 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Eisenberger N. I., Lieberman M. D., Williams K. D. (2003). Does rejection hurt? An FMRI study of social exclusion . Science 302 , 290–292. 10.1126/science.1089134 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Erber R., Erber M. W. (2000). The self-regulation of moods: second thoughts on the importance of happiness in everyday life . Psychol. Inq. 11 , 142–148 10.1207/S15327965PLI1103_02 [ CrossRef ] [ Google Scholar ]
• Eslinger P. J., Dennis K., Moore P., Antani S., Hauck R., Grossman M. (2005). Metacognitive deficits in frontotemporal dementia . J. Neurol. Neurosurg. Psychiatry 76 , 1630–1635. 10.1136/jnnp.2004.053157 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Fazio R. H., Effrein E. A., Falender V. J. (1981). Self-perceptions following social interaction . J. Pers. Soc. Psychol. 41 , 232–242 10.1037/0022-3514.41.2.232 [ CrossRef ] [ Google Scholar ]
• Fein S., Spencer S. J. (1997). Prejudice as self-image maintenance: affirming the self through derogating others . J. Pers. Soc. Psychol. 73 , 31–44 10.1037/0022-3514.73.1.31 [ CrossRef ] [ Google Scholar ]
• Feldman R., Weller A., Zagoory-Sharon O., Levine A. (2007). Evidence for a neuroendocrinological foundation of human affiliation: plasma oxytocin levels across pregnancy and the postpartum period predict mother-infant bonding . Psychol. Sci. 18 , 965–970. 10.1111/j.1467-9280.2007.02010.x [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Findlay S. D., Thagard P. (2012). How parts make up wholes . Front. Physiol. 3 :455. 10.3389/fphys.2012.00455 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Fisher H. E., Aron A., Brown L. (2006). Romantic love: a mammalian system for mate choice . Philos. Trans. R. Soc. B 361 , 2173–2186. 10.1098/rstb.2006.1938 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Fitzsimons G. M., Bargh J. A. (2003). Thinking of you: nonconscious pursuit of interpersonal goals associated with relationship partners . J. Pers. Soc. Psychol. 84 , 148–164. 10.1037/0022-3514.84.1.148 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Fitzsimons G. M., Fishbach A. (2010). Shifting closeness: interpersonal effects of personal goal progress . J. Pers. Soc. Psychol. 98 , 535–549. 10.1037/a0018581 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Fitzsimons G. M., Shah J. Y. (2008). How goal instrumentality shapes relationship evaluations . J. Pers. Soc. Psychol. 95 , 319–337. 10.1037/0022-3514.95.2.319 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Gailliot M. T., Mead N. L., Baumeister R. F. (2008). “Self-regulation,” in Handbook of Personality: Theory and Research , eds John O. P., Robbins R. W., Pervin L. A. (New York, NY: Guilford Press; ), 472–491. [ Google Scholar ]
• Goffman E. (1959). The Presentation of Self in Everyday Life . New York, NY: Anchor Books. [ Google Scholar ]
• Gonzaga G. C., Turner R. A., Keltner D., Campos B., Altemus M. (2006). Romantic love and sexual desire in close relationships . Emotion 6 , 163–179. 10.1037/1528-3542.6.2.163 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Heimpel S. A., Wood J. V., Marshall M. A., Brown J. D. (2002). Do people with low self-esteem really want to feel better? Self-esteem differences in motivation to repair negative moods . J. Pers. Soc. Psychol. 82 , 128–147. 10.1037/0022-3514.82.1.128 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Holmes J. G., Cameron J., Baldwin M. W. (2005). An Integrative Review of Theories of Interpersonal Cognition: An Interdependence Theory Perspective Interpersonal Cognition . New York, NY: Guilford Press, 415–447. [ Google Scholar ]
• Ikemoto S., Panksepp J. (1999). The role of nucleus accumbens dopamine in motivated behavior: a unifying interpretation with special reference to reward-seeking . Brain Res. Rev. 31 , 6–41. 10.1016/S0165-0173(99)00023-5 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Izuma K., Saito D. N., Sadato N. (2008). Processing of social and monetary rewards in the human striatum . Neuron 58 , 284–294. 10.1016/j.neuron.2008.03.020 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Izuma K., Saito D. N., Sadato N. (2009). Processing of the incentive for social approval in the ventral striatum during charitable donation . J. Cogn. Neurosci. 22 , 621–631. 10.1162/jocn.2009.21228 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• James W. (1890). The Principles of Psychology . New York, NY: H. Holt. [ Google Scholar ]
• Jenkins A. C., Mitchell J. P. (2011). Medial prefrontal cortex subserves diverse forms of self-reflection . Soc. Neurosci. 6 , 211–218. 10.1080/17470919.2010.507948 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Job V., Dweck C. S., Walton G. M. (2010). Ego depletion—is it all in your head? Implicit theories about willpower affect self-regulation . Psychol. Sci. 21 , 1686–1693. 10.1177/0956797610384745 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Johnson M. L. (2005). The Cambridge Handbook of Age and Ageing . Cambridge: Cambridge University Press. [ Google Scholar ]
• Kavaliers M., Choleris E. (2011). Sociality, pathogen avoidance, and the neuropeptides oxytocin and vasopressin . Psychol. Sci. 22 , 1367–1374. 10.1177/0956797611420576 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Kunda Z. (1999). Social Cognition: Making Sense of People . Cambridge, MA: MIT Press. [ Google Scholar ]
• Kwang T., Swann W. B., Jr. (2010). Do people embrace praise even when they feel unworthy? A review of critical tests of self-enhancement versus self-verification . Pers. Soc. Psychol. Rev. 14 , 263–280. 10.1177/1088868310365876 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Leary M. R., Baumeister R. F. (2000). “The nature and function of self-esteem: sociometer theory,” in Advances in Experimental Social Psychology , Vol. 32, ed. Zanna M. P. (San Diego, CA: Academic Press; ), 1–62. [ Google Scholar ]
• Leary M. R., Kowalski R. M. (1990). Impression management: a literature review and two-component model . Psychol. Bull. 107 , 34–47 10.1037/0033-2909.107.1.34 [ CrossRef ] [ Google Scholar ]
• Leary M. R., Tangney J. P. (2003). Handbook of Self and Identity . New York, NY: Guilford. [ Google Scholar ]
• Lieberman M. D. (2010). “Social cognitive neuroscience,” in Handbook of Social Psychology , 5th Edn, eds Fiske S. T., Gilbert D. T., Lindzey G. (New York, NY: McGraw-Hill; ), 143–193. [ Google Scholar ]
• MacDonald A. W., Cohen J. D., Stenger V. A., Carter C. S. (2000). Dissociating the role of the dorsolateral prefrontal and anterior cingulated cortex in cognitive control . Science 288 , 1835–1838. 10.1126/science.288.5472.1835 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• MacDonald G., Leary M. R. (2005). Why does social exclusion hurt? The relationship between social and physical pain . Psychol. Bull. 131 , 202–223. 10.1037/0033-2909.131.2.202 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Machery E. (2009). Doing without Concepts . Oxford: Oxford University Press. [ Google Scholar ]
• Markus H., Kunda Z. (1986). Stability and malleability of the self-concept . J. Pers. Soc. Psychol. 51 , 858–866. 10.1037/0022-3514.51.4.858 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Markus H. R., Kitayama S. (1991). Culture and the self: implications for cognition, emotion, and motivation . Psychol. Rev. 98 , 224–253 10.1037/0033-295X.98.2.224 [ CrossRef ] [ Google Scholar ]
• McCullough K. C., Fitzsimons G. M., Chua S. N. (2010). Vicarious Goal Satisfaction . Moscow, ID: University of Idaho. [ Google Scholar ]
• McGuire W. J., McGuire C. V. (1996). Enhancing self-esteem by directed-thinking tasks: cognitive and affective positivity asymmetries . J. Pers. Soc. Psychol. 70 , 1117–1125. 10.1037/0022-3514.70.6.1117 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• McGuire W. J., McGuire C. V., Child P., Fujioka T. (1978). Salience of ethnicity in the spontaneous self-concept as a function of one’s ethnic distinctiveness in the social environment . J. Pers. Soc. Psychol. 36 , 511–520. 10.1037/0022-3514.36.5.511 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Mead G. H. (1967). Mind, Self and Society from the Standpoint of a Social Behaviorist . Chicago, IL: University of Chicago Press. [ Google Scholar ]
• Mikolajczak M., Gross J. J., Lane A., Corneille O., de Timary P., Lumine L. (2010). Oxytocin makes people trusting, not gullible . Psychol. Sci. 21 , 1072–1074. 10.1177/0956797610377343 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Mitchell J. P. (2009). Inferences about other minds . Philos. Trans. R. Soc. B 364 , 1309–1316. 10.1098/rstb.2008.0318 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Molden D. C., Hui C. M., Scholer A. A., Meier B. P., Noreen E. E., Agostino P. R., et al. (2012). The motivational versus metabolic effects of carbohydrates on self-control . Psychol. Sci. 23 , 1137–1144. 10.1177/0956797612439069 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Muraven M., Collins R. L., Neinhaus K. (2002). Self-control and alcohol restraint: an initial application of the Self-Control Strength Model . Psychol. Addict. Behav. 16 , 113–120. 10.1037/0893-164X.16.2.113 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Murphy G. L. (2002). The Big Book of Concepts . Cambridge, MA: MIT Press. [ Google Scholar ]
• Murray S. L., Holmes J. G., Griffin D. W. (1996). The self-fulfilling nature of positive illusions in romantic relationships: love is not blind, but prescient . J. Pers. Soc. Psychol. 71 , 1155–1180. 10.1037/0022-3514.71.6.1155 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Neiss M. B., Sedikides C., Stevenson J. (2002). Self-esteem: a behavioral genetics perspective . Eur. J. Pers. 16 , 351–367 10.1002/per.456 [ CrossRef ] [ Google Scholar ]
• Northoff G., Bermpohl F. (2004). Cortical midline structures and the self . Trends Cogn. Sci. 8 , 102–107. 10.1016/j.tics.2004.01.004 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Onoda K., Okamoto Y., Nakashima K., Nittono H., Yoshimura S., Yamawaki S., et al. (2010). Does low self-esteem enhance social pain? The relationship between trait self-esteem and anterior cingulate cortex activation induced by ostracism . Soc. Cogn. Affect. Neurosci. 5 , 385–391. 10.1093/scan/nsq002 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Ortigue S., Bianchi-Demicheli F. (2010). Overlapping neural systems mediating self-consciousness, mirror neurons, and love: a combined fMRI and 4D EEG neuroimaging approach . Paper Presented at the Society for Personality and Social Psychology Conference: Las Vegas, NV. [ Google Scholar ]
• Ortigue S., Bianchi-Demicheli F., de C. Hamilton A. F., Grafton S. T. (2007). The neural basis of love as a subliminal prime: an event-related functional magnetic resonance imaging study . J. Cogn. Neurosci. 19 , 1218–1230. 10.1162/jocn.2007.19.7.1218 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Pettigrew T. F. (1967). Social evaluation theory: convergences and applications . Nebr. Symp. Motiv. 15 , 241–311. [ Google Scholar ]
• Richeson J. A., Baird A. A., Gordon H. L., Heatherton T. F., Wyland C. L., Trawalter S., et al. (2003). An fMRI investigation of the impact of interracial contact on executive function . Nat. Neurosci. 6 , 1323–1328. 10.1038/nn1156 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Richeson J. A., Shelton J. N. (2003). When prejudice does not pay: effects of interracial contact on executive function . Psychol. Sci. 14 , 287–290. 10.1111/1467-9280.03437 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Rochat P. (2009). Others in Mind: Social Origins of Self-Consciousness . Cambridge: Cambridge University Press. [ Google Scholar ]
• Rodrigues S. M., Saslow L. R., Garcia N., John O. P., Keltner D. (2009). Oxytocin receptor genetic variation relates to empathy and stress reactivity in humans . Proc. Natl. Acad. Sci. U.S.A. 106 , 21437–21441. 10.1073/pnas.0909579106 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Rosenthal R., Jacobson L. (1968). Pygmalion in the Classroom: Teacher Expectation and Pupils’ Intellectual Development . New York, NY: Holt, Rinehart & Winston. [ Google Scholar ]
• Roy M. A., Neale M. C., Kendler K. S. (1995). The genetic epidemiology of self-esteem . Br. J. Psychiatry 166 , 813–820. 10.1192/bjp.166.6.813 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Salthouse T. A. (2004). What and when of cognitive aging . Curr. Dir. Psychol. Sci. 14 , 0–144 10.1111/j.0963-7214.2004.00293.x [ CrossRef ] [ Google Scholar ]
• Saphire-Bernstein S., Way B. M., Kim H. S., Sherman D. K., Taylor S. E. (2011). Oxytocin receptor gene (OXTR) is related to psychological resources . Proc. Natl. Acad. Sci. U.S.A. 108 , 15118–15122. 10.1073/pnas.1113137108 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Schlenker B. R. (2003). “Self-presentation,” in Handbook of Self and Identity , eds Leary M. R., Tangney J. P. (New York, NY: Guilford Press; ), 492–518. [ Google Scholar ]
• Sedikides C., Brewer M. B. (2001). Individual Self, Relational Self, Collective Self . Hove: Psychology Press. [ Google Scholar ]
• Sedikides C., Spencer S. (2007). The Self . New York, NY: Psychology Press. [ Google Scholar ]
• Shrauger J. S., Rosenberg S. E. (1970). Self-esteem and the effects of success and failure feedback on performance . J. Pers. 38 , 404–417. 10.1111/j.1467-6494.1970.tb00018.x [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Sinclair L., Kunda Z. (2000). Motivated stereotyping of women: she’s fine if she praised me but incompetent if she criticized me . Pers. Soc. Psychol. Bull. 26 , 1329–1342 10.1177/0146167200263002 [ CrossRef ] [ Google Scholar ]
• Snyder M., Tanke E. D., Berscheid E. (1977). Social perception and interpersonal behavior: on the self-fulfilling nature of social stereotypes . J. Pers. Soc. Psychol. 35 , 656–666 10.1037/0022-3514.35.9.656 [ CrossRef ] [ Google Scholar ]
• Somerville L. H., Heatherton T. F., Kelley W. M. (2006). Anterior cingulate cortex responds differentially to expectancy violation and social rejection . Nat. Neurosci. 9 , 1007–1008. 10.1038/nn1728 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Somerville L. H., Kelley W. M., Heatherton T. F. (2010). Self-esteem modulates medial prefrontal cortical responses to evaluative social feedback . Cereb. Cortex 20 , 3005–3013. 10.1093/cercor/bhq049 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Spencer S. J., Fein S., Lomore C. D. (2001). Maintaining one’s self-image vis-à-vis others: the role of self-affirmation in the social evaluation of the self . Motiv. Emot. 25 , 41–65 10.1023/A:1010659805978 [ CrossRef ] [ Google Scholar ]
• Steele C. M. (1988). “The psychology of self-affirmation: sustaining the integrity of the self,” in Advances in Experimental Social Psychology , Vol. 21, ed. Berkowitz L. (New York, NY: Academic Press; ), 261–302. [ Google Scholar ]
• Stinson D. A., Cameron J. J., Wood J. V., Gaucher D., Holmes J. G. (2009). Deconstructing the reign of error: interpersonal warmth explains the self-fulfilling prophecy of anticipated acceptance . Pers. Soc. Psychol. Bull. 35 , 1165–1178. 10.1177/0146167209338629 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Stinson D. A., Logel C., Holmes J. G., Wood J. V., Hogle J. V., Gaucher D., et al. (2010). The regulatory function of self-esteem: testing to the acceptance and epistemic signaling systems . J. Pers. Soc. Psychol. 99 , 993–1013. 10.1037/a0020310 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Stinson D. A., Logel C., Zanna M. P., Holmes J. G., Cameron J. J., Wood J. V., et al. (2008a). The cost of lower self-esteem: testing a self- and social-bonds model of health . J. Pers. Soc. Psychol. 94 , 412–428. 10.1037/0022-3514.94.3.412 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Stinson D. A., Wood J. V., Doxey J. R. (2008b). In search of clarity: self-esteem and domains of confidence and confusion . Pers. Soc. Psychol. Bull. 34 , 1541–1555. 10.1177/0146167208323102 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Stone A. A., Schwartz J. E., Broderick J. E., Deaton A. (2010). A snapshot of the age distribution of psychological well-being in the United States . Proc. Natl. Acad. Sci. U.S.A. 107 , 9985–9990. 10.1073/pnas.1003744107 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Sui J., Han S. (2007). Self-construal priming modulates neural substrates of self-awareness . Psychol. Sci. 18 , 861–866. 10.1111/j.1467-9280.2007.01992.x [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Swann W. B., Jr. (2012). “Self-verification theory,” in Handbook of Theories of Social Psychology , eds Van Lang P., Kruglanski A., Higgins E. T. (New York, NY: Sage; ), 23–42. [ Google Scholar ]
• Swann W. B., Schroeder D. G. (1995). The search for beauty and truth: a framework for understanding reactions to evaluations . Pers. Soc. Psychol. Bull. 21 , 1307–1318 10.1177/01461672952112008 [ CrossRef ] [ Google Scholar ]
• Sylwester P. (2007). The Adolescent Brain: Reaching for Autonomy . Thousand Oaks, CA: Corwin Press. [ Google Scholar ]
• Tajfel H. (1974). Social identity and intergroup behavior . Soc. Sci. Inf. 13 , 65–93 10.1177/053901847401300204 [ CrossRef ] [ Google Scholar ]
• Taylor S. E. (2002). The Tending Instinct: Women, Men, and the Biology of Our Relationships . New York, NY: Holt. [ Google Scholar ]
• Taylor S. E., Burklund L. J., Eisenberger N. I., Lehman B. J., Hilmert C. J., Lieberman M. D. (2008). Neural bases of moderation of cortisol stress responses by psychosocial resources . J. Pers. Soc. Psychol. 95 , 197–211. 10.1037/0022-3514.95.1.197 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Taylor S. E., Lerner J. S., Sherman D. K., Sage R. M., McDowell N. K. (2003). Portrait of the self-enhancer: well adjusted and well liked or maladjusted and friendless? J. Pers. Soc. Psychol. 84 , 165–176. 10.1037/0022-3514.84.1.165 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Thagard P. (2006). Hot Thought: Mechanisms and Applications of Emotional Cognition . Cambridge, MA: MIT Press. [ Google Scholar ]
• Thagard P. (2010). The Brain and the Meaning of Life . Princeton, NJ: Princeton University Press. [ Google Scholar ]
• Thagard P. (2012). The Cognitive Science of Science: Explanation, Discovery, and Conceptual Change . Cambridge, MA: MIT Press. [ Google Scholar ]
• Thagard P. (2014). The self as a system of multilevel interacting mechanisms . Philos. Psychol. 27 , 145–163 10.1080/09515089.2012.725715 [ CrossRef ] [ Google Scholar ]
• Thagard P., Aubie B. (2008). Emotional consciousness: a neural model of how cognitive appraisal and somatic perception interact to produce qualitative experience . Conscious. Cogn. 17 , 811–834. 10.1016/j.concog.2007.05.014 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Thagard P., Litt A. (2008). “Models of scientific explanation,” in The Cambridge Handbook of Computational Psychology , ed. Sun R. (Cambridge: Cambridge University Press; ), 549–564. [ Google Scholar ]
• Tice D. M., Butler J. L., Muraven M. B., Stillwell A. M. (1995). When modesty prevails: differential favorability of self-presentation to friends and strangers . J. Pers. Soc. Psychol. 69 , 1120–1138 10.1037/0022-3514.69.6.1120 [ CrossRef ] [ Google Scholar ]
• Tice D. M., Wallace H. M. (2003). “The reflected self: creating yourself as (you think) others see you,” in Handbook of Self and Identity , eds Leary M. R., Tangney J. P. (New York, NY: Guilford Press; ), 91–105. [ Google Scholar ]
• Twenge J. M., Campbell W. K. (2003). “Isn’t it fun to get the respect that we’re going to deserve?” Narcissism, social rejection, and aggression . Pers. Soc. Psychol. Bull. 29 , 261–272. 10.1177/0146167202239051 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Unkelbach C., Guastella A. J., Forgas J. P. (2008). Oxytocin selectively facilitates recognition of positive sex and relationship words . Psychol. Sci. 19 , 1092–1094. 10.1111/j.1467-9280.2008.02206.x [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Vandekerckhove M., von Scheve C., Ismer S., Jung S., Kronast S. (2008). Regulating Emotions: Culture, Social Necessity, and Biological Inheritance . Malden, MA: Blackwell. [ Google Scholar ]
• Vohs K. D., Baumeister R. F., Ciarocco N. J. (2005). Self-regulation and self-presentation: regulatory resource depletion impairs impression management and effortful self-presentation depletes regulatory resources . J. Pers. Soc. Psychol. 88 , 632–657. 10.1037/0022-3514.88.4.632 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Walton G. M., Cohen G. L., Cwir D., Spencer S. J. (2012). Mere belonging: the power of social connections . J. Pers. Soc. Psychol. 102 , 513–532. 10.1037/a0025731 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Watson D., Suls J., Haig J. (2002). Global self-esteem in relation to structural models of personality and affectivity . J. Pers. Soc. Psychol. 83 , 185–197. 10.1037/0022-3514.83.1.185 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Way B. M., Taylor S. E., Eisenberger N. I. (2009). Variation in the k-opioid receptor gene (OPRM1) is associated with dispositional and neural sensitivity to social rejection . Proc. Natl. Acad. Sci. U.S.A. 106 , 15079–15084. 10.1073/pnas.0812612106 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Wood J. V. (1989). Theory and research concerning social comparisons of personal attributes . Psychol. Bull. 106 , 231–248 10.1037/0033-2909.106.2.231 [ CrossRef ] [ Google Scholar ]
• Wood J. V., Giordano-Beech M., Ducharme M. J. (1999). Compensating for failure through social comparison . Pers. Soc. Psychol. Bull. 25 , 1370–1386 10.1177/0146167299259004 [ CrossRef ] [ Google Scholar ]
• Wood J. V., Heimpel S. A., Manwell L. A., Whittington E. J. (2009a). This mood is familiar and I don’t deserve to feel better anyway: mechanisms underlying self-esteem differences in motivation to repair sad moods . J. Pers. Soc. Psychol. 96 , 363–380. 10.1037/a0012881 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Wood J. V., Perunovic W. Q. E., Lee J. W. (2009b). Positive self-statements: power for some, peril for others . Psychol. Sci. 20 , 860–866. 10.1111/j.1467-9280.2009.02370.x [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Wood J. V., Taylor S. E., Lichtman R. R. (1985). Social comparison in adjustment to breast cancer . J. Pers. Soc. Psychol. 49 , 1169–1183. 10.1037/0022-3514.49.5.1169 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Zayas V., Shoda Y., Mischel W., Osterhout L., Takahashi M. (2009). Neural responses to partner rejection cues . Psychol. Sci. 20 , 813–821. 10.1111/j.1467-9280.2009.02373.x [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Zeigler-Hill V., Jordan C. H. (2011). “Two faces of self-esteem: implicit and explicit forms of self-esteem,” in Handbook of Implicit Social Cognition: Measurement, Theory, and Applications , eds Gawronski B., Payne B. K. (New York, NY: Guilford Press; ), 392–407. [ Google Scholar ]

Self-Presentation Theory: Self-Construction and Audience Pleasing

Cite this chapter.

• Roy F. Baumeister &
• Debra G. Hutton  

Part of the book series: Springer Series in Social Psychology ((SSSOC))

2508 Accesses

59 Citations

59 Altmetric

Self-presentation is behavior that attempts to convey some information about oneself or some image of oneself to other people. It denotes a class of motivations in human behavior. These motivations are in part stable dispositions of individuals but they depend on situational factors to elicit them. Specifically, self-presentational motivations are activated by the evaluative presence of other people and by others’ (even potential) knowledge of one’s behavior.

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

Subscribe and save.

• Get 10 units per month
• Download Article/Chapter or Ebook
• 1 Unit = 1 Article or 1 Chapter
• Cancel anytime
• Available as EPUB and PDF
• Read on any device
• Instant download
• Own it forever
• Compact, lightweight edition
• Dispatched in 3 to 5 business days
• Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

Unable to display preview.  Download preview PDF.

Similar content being viewed by others

Self-Determination Theory

Psychologically Flexible Self-Acceptance

Introduction to the self-determination construct.

Adler, A (1921). The neurotic constitution: Outlines of a comparative individualistic psychology and psychotherapy . New York: Moffat Yard.

Google Scholar  

Aries, P. (1981). The hour of our death . New York: Knopf.

Baumeister, R. F. (1982a). A self-presentational view of social phenomena. Psychological Bulletin, 91 , 3–26.

Article   Google Scholar  

Baumeister, R. F. (1982b). Self-esteem, self-presentation, and future interaction: A dilemma of reputation. Journal of Personality, 50 , 29–45.

Baumeister, R. F. (1984). Choking under pressure: Self-consciousness and paradoxical effects of incentives on skillful performance. Journal of Personality and Social Psychology, 46 , 610–620.

Article   PubMed   Google Scholar  

Baumeister, R. F. (1985). The championship choke. Psychology Today, 19 (4:April), 48–52.

Baumeister, R. F. (1986). Identity . New York: Oxford University Press.

Baumeister, R F, Hamilton, J. C., & Tice, D. M. (1985). Public versus private expectancy of success: Confidence booster or performance pressure? Journal of Personality and Social Psychology, 48 , 1447–1457.

Baumeister, R. F., & Jones, E. E. (1978). When self-presentation is constrained by the target’s prior knowledge: Consistency and compensation. Journal of Personality and Social Psychology, 36 , 608–618.

Baumeister, R. F., & Steinhilber, A (1984). Paradoxical effects of supportive audiences on performance under pressure: The home field disadvantage in sports championships. Journal of Personality and Social Psychology, 47 , 85–93.

Baumeister, R. F., & Tice, D. M. (1984). Role of self-presentation and choice in cognitive dissonance under forced compliance: Necessary or sufficient causes? Journal of Personality and Social Psychology, 46 , 5–13.

Baumeister, R. F., & Tice, D. M. (1985). Self-esteem and responses to success and failure: Subsequent performance and intrinsic motivation. Journal of Personality, 53 , 450–467.

Bond, C. F. (1982). Social facilitation: A self-presentational view. Journal of Personality and Social Psychology, 42 , 1042–1050.

Bond, C. F., & Titus, L. J. (1983). Social facilitation: A meta-analysis of 241 studies. Psychological Bulletin, 94 , 265–292.

Braginsky, B. M., Braginsky, D. D., & Ring, K. (1969). Methods of madness: The mental hospital as a last resort . New York: Holt, Rinehart & Winston.

Castaneda, C. (1972). Journey to Ixtlan: The lessons of Don Juan . New York: Simon & Schuster.

Deaux, K, & Major, B. (1977). Sex-related patterns in the unit of perception. Personality and Social Psychology Bulletin, 3 , 297–300.

Emmler, N. (1984). Differential involvement in delinquency: Toward an interpretation in terms of reputation management. Progress in Experimental Personality Research, 13 , 174–239.

Festinger, L., & Carlsmith, J. M. (1959). Cognitive consequences of forced compliance. Journal of Abnormal and Social Psychology, 58 , 203–210.

Felson, R (1978). Aggression as impression management. Social Psychology Quarterly, 41 , 205–213.

Gollwitzer, P. M. (1986). Striving for specific identities: The social reality of self-symbolizing. In R. Baumeister (Ed.), Public self and private self . New York: Springer-Verlag.

Greenberg, J. (1983). Self-image versus impression management in adherence to distributive justice standards: The influence of self-awareness and self-consciousness. Journal of Personality and Social Psychology, 44 , 5–19.

Hinkle, L. (1957). [Untitled.] In Methods of forceful indoctrination: Observations and interviews . New York.

Hogan, R (1982). A socioanalytic theory of personality. In M. Page (Ed.), Nebraska symposium on motivation (pp. 55–89). Lincoln, NE: University of Nebraska Press.

Hogan, R, Mankin, D., Conway, J., & Fox, S. (1970). Personality correlates of undergraduate marijuana use. Journal of Consulting and Clinical Psychology, 35 , 58–63.

Houghton, W. E. (1957). The Victorian frame of mind: 1830–1870 . New Haven: Yale University Press.

Jones, E. E., & Berglas, S. C. (1978). Control of attributions about the self through self-handicapping strategies: The appeal of alcohol and the role of underachievement. Personality and Social Psychology Bulletin, 4 , 200–206.

Jones, E. E., & Pittman, T. S. (1982). Toward a general theory of strategic self-presentation. In J. Suls (Ed.), Psychological perspectives on the self (Vol. 1, pp. 231–262). Hillsdale, NJ: Erlbaum.

Kassin, S. M. (1984) T. V. Cameras, public self-consciousness and mock juror performance. Journal of Experimental Social Psychology, 20 , 336–349.

Kett, J. F. (1977). Rites of passage: Adolescence in America 1790 to the present . New York: Basic.

Kidder, L. H., Bellettirie, G., & Cohn, E. S. (1977). Secret ambitions and public performances: The effects of anonymity on reward allocations made by men and women. Journal of Experimental Social Psychology, 13 , 70–80.

Kolditz, T. A, & Arkin, R. M. (1982). An impression management interpretation of the self-handicapping strategy. Journal of Personality and Social Psychology, 43 , 492–502.

Latané, B., Williams, K, & Harkins, S. (1979). Many hands make light the work: The causes and consequences of social loafing. Journal of Personality and Social Psychology, 37 , 822–832.

Lifton, R. J. (1957). [Untitled.] In Methods of forceful indoctrination: Observations and interviews . New York.

Major, B., & Adams, J. B. (1983). Role of gender, interpersonal orientation, and self-presentation in distributive-justice behavior. Journal of Personality and Social Psychology, 45 , 598–608.

Major, B., McFarlin, D. B., & Gagnon, D. (1984). Overworked and underpaid: On the nature of gender differences in personal entitlement. Journal of Personality and Social Psychology, 47 , 1399–1412.

McFarlin, D. B., Baumeister, R. F., & Blascovich, J. (1984). On knowing when to quit: Task failure, self-esteem, advice, and nonproductive persistence. Journal of Personality, 52 , 138–155.

Morris, C. (1972). The discovery of the individual: 1050–1200 . New York: Harper & Row.

Paulhus, D. (1982). Individual differences, self-presentation, and cognitive dissonance: Their concurrent operation in forced compliance. Journal of Personality and Social Psychology, 43 , 838–852.

Pennebaker, J. W. (1984). Confiding, ruminating, and psychosomatic disease. In J. W. Pennebaker (Chair), New paradigms in psychology . Symposium conducted at the annual convention of the American Psychological Association, Toronto, Canada, August 1984.

Pennebaker, J. W. (in press). Traumatic experience and psychosomatic disease: Exploring the roles of behavioral inhibition, obsession, and confiding. Canadian Psychology .

Sacco, W. P., & Hokanson, J. E. (1982). Depression and self-reinforcement in a public and private setting. Journal of Personality and Social Psychology, 42 , 377–385.

Schlenker, B. R. (1980). Impression management: The self-concept, social identity, and interpersonal relations . Monterey, CA: Brooks/Cole.

Schlenker, B. R. (1982). Translating actions into attitudes: An identity-analytic approach to the explanation of social conduct. In L. Berkowitz (Ed.), Advances in experimental social psychology (Vol. 15 pp. 194–247). New York: Academic Press.

Scott, M. B., & Lyman, S. M. (1968). Accounts. American Sociological Review, 33 , 46–62.

Silverman, I. (1964). Self-esteem and differential responsiveness to success and failure. Journal of Abnormal and Social Psychology, 69 , 115–119.

Smith, T. W, Snyder, C. R, & Perkins, S. C. (1983). The self-serving function of hypochondriacal complaints: Physical symptoms as self-handicapping strategies. Journal of Personality and Social Psychology, 44 , 787–797.

Sweeney, J. (1973). An experimental investigation of the free rider problem. Social Science Research, 2 , 277–292.

Tang, T. L. P., & Baumeister, R. F. (1984). Effects of personal values, perceived surveillance, and task labels on task preference: The ideology of turning play into work. Journal of Applied Psychology, 69 , 99–105.

Tedeschi, J. T., Schlenker, B. R, & Bonoma, T. V. (1971). Cognitive dissonance: Private ratiocination or public spectacle? American Psychologist, 26 , 685–695.

Tice, D. M., & Baumeister, R F. (1985). Self-esteem, self-handicapping, and self-presentation: The benefits of not practicing. Unpublished manuscript, Case Western Reserve University.

Toch, H. (1969). Violent men . Chicago: Aldine.

Wicklund, R. A, & Gollwitzer, P. M. (1982). Symbolic self-completion . Hillsdale, NJ: Erlbaum.

Zajonc, R (1965). Social facilitation. Science, 149 , 269–274.

Download references

You can also search for this author in PubMed   Google Scholar

Editor information

Editors and affiliations.

Department of Psychology, Syracuse University, 13210, Syracuse, New York, USA

Brian Mullen

Department of Psychology, Williams College, 01267, Williamstown, Massachusetts, USA

George R. Goethals

Rights and permissions

Reprints and permissions

Copyright information

© 1987 Springer-Verlag New York Inc.

About this chapter

Baumeister, R.F., Hutton, D.G. (1987). Self-Presentation Theory: Self-Construction and Audience Pleasing. In: Mullen, B., Goethals, G.R. (eds) Theories of Group Behavior. Springer Series in Social Psychology. Springer, New York, NY. https://doi.org/10.1007/978-1-4612-4634-3_4

Download citation

DOI : https://doi.org/10.1007/978-1-4612-4634-3_4

Publisher Name : Springer, New York, NY

Print ISBN : 978-1-4612-9092-6

Online ISBN : 978-1-4612-4634-3

eBook Packages : Springer Book Archive

Share this chapter

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Publish with us

Policies and ethics

• Find a journal
• Track your research

Special Report: Is Social Media Misuse A Bad Habit or Harmful Addiction?

Information & authors, metrics & citations, view options.

When Is the Line Crossed?

Suggested screening tools.

Setting Treatment Goals

What can parents do.

Appreciating the Scope of the Problem

Need for policy setting, logging off, biographies.

Information

Published in.

• social media
• social media addiction
• internet gaming disorder
• behavioral addiction
• pathological use
• child and adolescent psychiatry
• substance use disorder
• passive scrolling
• fear of missing out
• Social Media Addiction Scale
• contingency management
• behavioral contract
• family therapy
• cognitive-behavioral therapy
• psychodynamic therapy
• youth mental health
• age restrictions
• teens and tweens
• digital policy
• Ron DeSantis
• Surgeon General Advisory
• Common Sense Media
• James Sherer
• Petros Levounis

Affiliations

Export citations.

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu .

To download the citation to this article, select your reference manager software.

There are no citations for this item

View options

Login options.

Already a subscriber? Access your subscription through your login credentials or your institution for full access to this article.

Not a subscriber?

Subscribe Now / Learn More

PsychiatryOnline subscription options offer access to the DSM-5-TR ® library, books, journals, CME, and patient resources. This all-in-one virtual library provides psychiatrists and mental health professionals with key resources for diagnosis, treatment, research, and professional development.

Need more help? PsychiatryOnline Customer Service may be reached by emailing [email protected] or by calling 800-368-5777 (in the U.S.) or 703-907-7322 (outside the U.S.).

Share article link

Copying failed.

PREVIOUS ARTICLE

Next article, request username.

Can't sign in? Forgot your username? Enter your email address below and we will send you your username

If the address matches an existing account you will receive an email with instructions to retrieve your username

Create a new account

Change password, password changed successfully.

Your password has been changed

Reset password

Can't sign in? Forgot your password?

Enter your email address below and we will send you the reset instructions

If the address matches an existing account you will receive an email with instructions to reset your password.

Your Phone has been verified

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Open access
• Published: 11 July 2024

Direct presentation of inflammation-associated self-antigens by thymic innate-like T cells induces elimination of autoreactive CD8 + thymocytes

• Yuanyuan You 1 , 2   na1 ,
• Josefine Dunst 1 , 2   na1 ,
• Kewei Ye 1 , 2 ,
• Patrick A. Sandoz   ORCID: orcid.org/0000-0002-8379-7267 3 ,
• Annika Reinhardt 1 , 2 ,
• Inga Sandrock 4 ,
• Natalia R. Comet 2 , 5 ,
• Rupak Dey Sarkar   ORCID: orcid.org/0009-0008-0203-5772 6 ,
• Emily Yang   ORCID: orcid.org/0000-0002-6028-2455 7 ,
• Estelle Duprez   ORCID: orcid.org/0000-0003-3810-5740 8 , 9 ,
• Judith Agudo 10 , 11 , 12 , 13 ,
• Brian D. Brown   ORCID: orcid.org/0000-0002-3670-8778 14 , 15 , 16 ,
• Paul J. Utz   ORCID: orcid.org/0000-0003-1181-1565 7 , 17 ,
• Wolfgang Kastenmüller   ORCID: orcid.org/0000-0002-3835-1485 6 ,
• Carmen Gerlach   ORCID: orcid.org/0000-0001-7889-2393 2 , 5 ,
• Immo Prinz 4 , 18 , 19 ,
• Björn Önfelt   ORCID: orcid.org/0000-0001-5178-7593 3 , 20 &
• Taras Kreslavsky   ORCID: orcid.org/0000-0002-6672-1914 1 , 2  

Nature Immunology ( 2024 ) Cite this article

2190 Accesses

52 Altmetric

Metrics details

• Cytotoxic T cells

Upregulation of diverse self-antigens that constitute components of the inflammatory response overlaps spatially and temporally with the emergence of pathogen-derived foreign antigens. Therefore, discrimination between these inflammation-associated self-antigens and pathogen-derived molecules represents a unique challenge for the adaptive immune system. Here, we demonstrate that CD8 + T cell tolerance to T cell-derived inflammation-associated self-antigens is efficiently induced in the thymus and supported by redundancy in cell types expressing these molecules. In addition to thymic epithelial cells, this included thymic eosinophils and innate-like T cells, a population that expressed molecules characteristic for all major activated T cell subsets. We show that direct T cell-to-T cell antigen presentation by minute numbers of innate-like T cells was sufficient to eliminate autoreactive CD8 + thymocytes. Tolerance to such effector molecules was of critical importance, as its breach caused by decreased thymic abundance of a single model inflammation-associated self-antigen resulted in autoimmune elimination of an entire class of effector T cells.

Similar content being viewed by others

Developmental self-reactivity determines pathogenic Tc17 differentiation potential of naive CD8+ T cells in murine models of inflammation

Mucosal tissue regulatory T cells are integral in balancing immunity and tolerance at portals of antigen entry

B7-CD28 co-stimulation modulates central tolerance via thymic clonal deletion and Treg generation through distinct mechanisms

The generation of a diverse antigen receptor repertoire through V(D)J recombination inevitably produces self-reactive receptors in some developing lymphocytes. To prevent autoimmunity, these self-reactive cells must be inactivated either at the site of development (central tolerance) or in secondary lymphoid organs (peripheral tolerance). Central tolerance requires the presence of antigens at the site of lymphocyte differentiation. In the thymus, several mechanisms ensure the breadth of thymocyte exposure to peripheral antigens. A wide range of tissue-restricted antigens show ‘ectopic’ expression in medullary thymic epithelial cells (mTECs) 1 , 2 , 3 , and some mTECs induce large parts of molecular programs of various peripheral cell types 4 , 5 , 6 , 7 . The thymus also harbors all major subsets of dendritic cells (DCs) that can present both endogenously expressed and TEC-derived antigens 8 , 9 . Migration of peripheral DCs into the thymus further expands the spectrum of tissue-specific antigens represented in the thymus 8 , 10 . Finally, another professional antigen-presenting cell (APC) type, thymic B cells, also contributes to the induction of T cell tolerance 11 , 12 , 13 .

Self-reactive thymocytes are inactivated by negative selection 14 , eviction of immature cells from the thymus 15 and diversion into lineages with regulatory or innate-like properties 16 . Differentiation of innate-like T cells represents the execution of one of the specialized effector programs (for example, type 1 helper T (T H 1) cell-, type 2 helper T (T H 2) cell- or interleukin-17 (IL-17)-producing helper T (T H 17) cell-like 17 , 18 ) following antigen encounter in the thymus. These cells can express genes encoding inflammatory mediators and cytotoxic molecules at steady state 18 , 19 , 20 and often home to barrier tissues, where they contribute to the first line of defense against pathogens and regulate tissue homeostasis 21 , 22 .

However, many innate-like T cells found in the thymus, including a large fraction of γδT cells and the majority of invariant natural killer T (iNKT) cells, are not newly developed immature cells but mature tissue-resident lymphocytes 23 , 24 . Inflammatory mediators secreted by these cells have a broad impact on other components of the thymic microenvironment. For example, type 2 cytokines derived from innate-like cells support the intrathymic generation of innate-like interferon-γ (IFNγ)-producing CD8 + T cells 25 , 26 , regulate the recruitment of thymic eosinophils 27 , affect TEC function 28 and induce the activation of thymic DCs 29 . Intriguingly, other inflammatory pathways, for example, type 1/type 3 IFN signaling and MyD88-dependent signaling in TECs 30 , 31 , are also constitutively activated in the thymus. Therefore, the thymus has evolved to harbor a complex constitutively active inflammatory network, and thymus-resident innate-like T cells represent one of its central nodes. The reasons for the activation of numerous inflammatory pathways in the organ where pathogen encounter is unlikely remain unclear.

If autoreactive T cells escape central tolerance and encounter antigen in secondary lymphoid organs in the absence of inflammation, they are inactivated by peripheral tolerance mechanisms 32 . Mature T lymphocytes will only undergo clonal expansion and differentiation into effector cells if they have received co-stimulatory signals that are provided by APCs only in the context of inflammation. The induction of T cell effector programs whose components constitute self-antigens therefore coincides both spatially and temporally with the presence of a pathogen. Breach of tolerance to such antigens would result in a ‘fratricide’ reaction that would curtail any further immune response involving expression of this molecule. It remains unclear how the immune system discriminates such inflammation-associated self-antigens from antigens originating from the pathogen itself.

In this study, we aimed to investigate the mechanisms of tolerance to T cell-derived inflammation-associated self-antigens. Using model inflammation-associated self-antigens, we demonstrate that CD8 + T cell tolerance to these molecules can be induced in the thymus. The high efficiency of this tolerance was ensured by multiple redundant cellular sources of these antigens in the thymus, which, in addition to TECs, included thymic innate-like T cells and thymic eosinophils. Expression of a self-antigen by minute numbers of thymic innate-like T cells was sufficient to mediate remarkably efficient elimination of autoreactive CD8 + thymocytes that occurred through direct T cell-to-T cell antigen presentation. These results suggest that constitutive expression of inflammation-associated molecules in the thymus may have evolved to ensure the induction of tolerance to this unique class of self-antigens.

Innate-like T cells as libraries of T cell effector antigens

To start unraveling mechanisms of tolerance induction to T cell-derived inflammation-associated self-antigens, we analyzed the expression of a selection of genes encoding T cell effector molecules ( Il4 , Il13 , Ifng , Il17a , Il17f and Gzmb ) and their upstream regulators ( Eomes and Tbx21 ) in thymic cell subsets. Analysis of bulk transcriptomics data from thymic cell types available in the Immunological Genome (Immgen) database 33 , 34 (Fig. 1a ) and in the integrated single-cell RNA-sequencing (scRNA-seq) mouse thymus atlas 6 , 35 , 36 (Fig. 1b ) demonstrated that professional thymic APCs, such as TECs and thymic DCs, express no or low levels of many of these molecules. Instead, the highest levels of expression of most of these molecules in the thymus overlapped with the expression of Zbtb16 , the gene encoding the transcription factor PLZF that orchestrates effector programs of many innate-like T cell populations 37 , 38 , 39 , 40 (Fig. 1b ). Analysis of the Immgen dataset confirmed predominant expression of effector T cell molecules in iNKT and γδT cell subsets (Fig. 1a ). This pattern of expression was also conserved in humans as determined by analysis of data from the human scRNA-seq thymus atlas 35 (Extended Data Fig. 1 ). Thus, in contrast to professional APCs, thymic innate-like T cells express high levels of effector molecules characteristic of all major effector T cell subsets and would represent perfect libraries of T cell effector program antigens.

a , Expression of Il4 , Ifng and Gzmb by mouse thymic cell subsets. Data are from the Immgen database (microarray dataset). b , Uniform manifold approximation and projections (UMAPs) highlighting the expression of indicated genes in the mouse thymus cell atlas scRNA-seq dataset; AU, arbitrary units.

Source data

Cd8 + t cell tolerance to a model inflammation self-antigen.

To start characterizing tolerance to inflammation-associated self-antigens, we first took advantage of the predominant expression of Il4 by innate-like T cells in the mouse thymus (Fig. 1a,b ) and exploited green fluorescent protein (GFP) in Il4 -IRES-GFP mice (referred to hereafter as IL-4–GFP mice) 41 as a generic model of antigen expressed by thymic innate-like T cells. Immunization with a major histocompatibility complex (MHC) class I (H2-K d ) GFP 200–208 epitope 42 resulted in a prominent CD8 + T cell response in wild-type (WT) mice, but no response was detected in IL-4–GFP animals (Fig. 2a ), indicating a remarkably efficient CD8 + T cell tolerance to GFP in this system. By contrast, immunization with an MHC class II (I-A b ) GFP 81–95 epitope 43 resulted in comparable CD4 + T cell responses in WT and IL-4–GFP mice (Fig. 2b ). Thus, expression of IL-4–GFP resulted in strong CD8 + , but not CD4 + , T cell tolerance.

a , WT and IL-4–GFP mice on a C57BL/6J × BALB/c F1 (CB6F1) genetic background were immunized intraperitoneally with GFP 200–208 peptide using anti-CD40 and poly(I:C) as adjuvant or were left unimmunized (WT only). Six days after immunization, splenic H2-K d GFP 200–208 tetramer-binding CD8 + T cells were quantified by flow cytometry. Representative flow cytometry plots gated on CD8 + CD44 + T cells (left) and quantification of frequencies (from total CD8 + T cells) and absolute numbers (right) are shown ( n  = 5 mice per group). The data are representative of four independent experiments. b , WT and IL-4–GFP mice on a CB6F1 genetic background were immunized subcutaneously with GFP 81–95 peptide in complete Freund’s adjuvant or were left unimmunized (WT only). Fourteen days after immunization, I-A b GFP 81–95 tetramer-binding cells were magnetically enriched from pooled spleens and lymph nodes and quantified by flow cytometry. Representative flow cytometry plots gated on CD4 + T cells (left) and absolute numbers of CD4 + CD44 + tetramer + T cells (right) are shown ( n  = 2 mice for nonimmunized, n  = 5 for the other groups). Data are representative of two independent experiments; LN, lymph node. c , WT and IL-4–GFP mice (on a CB6F1 background) were lethally irradiated and reconstituted with syngeneic WT or IL-4–GFP BM cells depleted of T and NK cells. The resulting four groups of BM chimeras were immunized with GFP 200–208 peptide ≥7 weeks after reconstitution and analyzed 6 days after immunization, as described in a . WT CB6F1 mice were used as an unimmunized control. Representative plots demonstrating tetramer binding by CD8 + CD44 + T cells (left) and quantification of the frequency of CD8 + CD44 + tetramer + cells from total CD8 + T cells and their absolute numbers (right) are shown ( n  = 6 mice for nonimmunized, n  = 7 for WT → WT, n  = 7 for IL-4–GFP → WT, n  = 5 for WT → IL-4–GFP and n  = 6 for IL-4–GFP → IL-4–GFP). Results are pooled from two independent experiments. Data are presented as mean ± s.d. (NS, not significant ( P  > 0.05); * P  < 0.05 and **** P  < 0.0001) and were analyzed by two-tailed Student’s t -test ( b ) or one-way analysis of variance (ANOVA) with a Holm–Sidak multiple comparisons test ( a and c ).

Next, to assess the contribution of hematopoietic and stromal cells to the induction of CD8 + T cell tolerance, we established WT → WT, IL-4–GFP → WT, WT → IL-4–GFP and IL-4–GFP → IL-4–GFP bone marrow (BM) chimeras and immunized them with the GFP 200–208 peptide. A clear expansion of GFP-specific CD8 + T cells was observed only in the WT → WT group, whereas the frequency of tetramer + cells in all other groups was similar to that in unimmunized controls (Fig. 2c ). Together, these results reveal efficient induction of CD8 + T cell tolerance to a model inflammation-associated self-antigen, with a redundant role of hematopoietic and radioresistant cells in this process.

Central tolerance to a model inflammation self-antigen

We next sought to assess if tolerance to IL-4–GFP was already established in the thymus. Analysis of IL-4–GFP expression revealed that only 0.5 ± 0.2% (mean ± s.d.) of hematopoietic cells in the thymus were GFP + , of which 76.9 ± 3.3% were innate-like T cells and 17.7 ± 3.4% represented thymic eosinophils (Fig. 3a and Extended Data Fig. 2a,b ). GFP expression was also detectable in 0.8 ± 0.2% of mTECs (Extended Data Fig. 2c ). Immunofluorescence microscopy revealed that GFP + SiglecF + eosinophils and GFP + SiglecF – innate-like lymphocytes were present both in the thymic cortex and medulla, with more GFP + lymphocytes located in the medulla (Fig. 3b and Extended Data Fig. 2d ).

a , GFP expression by thymic nonstromal populations in IL-4–GFP mice. Frequency of GFP + cells ( n  = 5 mice) and pie chart showing frequencies of different subsets within the GFP + compartment (average percentage ± s.d.; n  = 3 mice). See also Extended Data Fig. 2a–c . b , Images of IL-4–GFP thymus sections as analyzed by confocal immunofluorescence microscopy. The medulla was identified by staining with UEA1 lectin (blue). IL-4–GFP + eosinophils were distinguished from IL-4–GFP + lymphocytes (green) by co-staining with anti-Siglec-F (red). See also Extended Data Fig. 2d . c , WT and IL-4–GFP mice (on a BALB/c (H2 d ) background; CD45.2) were lethally irradiated and reconstituted with syngeneic WT or IL-4–GFP BM cells mixed with BM cells from Jedi mice (B10.D2 genetic background (H2 d ); CD45.1). Thymi of the chimeras were analyzed 6 weeks after reconstitution ( n  = 4 chimeras for analysis of thymi in WT + Jedi-TCRαβ → WT; n  = 6 for the other groups). Jedi thymocytes were gated as CD45.1 + tetramer + cells. Expression of CD4 and CD8β on CD45.1 + tetramer + cells and viability dye and PD-1 staining of CD45.1 + tetramer + CD4 + CD8β + (Jedi DP) cells are shown. The frequencies of CD4 + CD8β + (DP) and CD4 – CD8β + (CD8SP) cells of CD45.1 + tetramer + Jedi thymocytes and the frequencies of dead Jedi DP cells were quantified (bottom). Data are representative of three independent experiments; Tet, tetramer. d , Analysis of the frequency of cleaved caspase-3 + cells among tetramer + CD4 + CD8β + (Jedi DP) cells in WT + Jedi-TCRαβ → WT and IL-4–GFP + Jedi-TCRαβ → WT mixed BM chimeras (from the experiment shown in Supplementary Fig. 2 ). Data are from one experiment with four chimeras per group; Casp3, caspase-3. e , Representative flow cytometric analysis of splenocytes from four groups of BM chimeras (same experiment as in c ). Jedi cells were identified by H2-K d GFP 200–208 tetramer staining, and CD8α, CD8β and CD4 expression on these cells was analyzed. The frequencies of total and CD8α hi CD8β hi tetramer-binding cells among splenocytes were quantified (bottom). Data are presented as mean ± s.d. (* P  < 0.05, ** P  < 0.01, *** P  < 0.001 and **** P  < 0.0001) and were analyzed by two-tailed Student’s t -test ( d ) or one-way ANOVA with a Holm–Sidak multiple comparisons test ( c and e ).

We next tested if the expression of IL-4–GFP by hematopoietic and/or stromal cells would result in the inactivation of autoreactive CD8 + T cells already in the thymus. We took advantage of Jedi T cell antigen receptor-αβ (Jedi-TCRαβ) mice, in which T cells express prerearranged chains of the H2-K d GFP 200–208 -specific TCR from the endogenous Tcra and Tcrb loci 44 . We generated BM chimeras by transferring a mix of Jedi-TCRαβ and WT or Jedi-TCRαβ and IL-4–GFP BM cells into WT or IL-4–GFP recipients and analyzed T cell development in these four groups of BM chimeras. As expected, in the absence of IL-4–GFP, the Jedi thymocyte compartment in WT + Jedi-TCRαβ → WT chimeras included CD4/CD8-double-negative (DN), CD4/CD8-double-positive (DP) and CD8-single-positive (CD8SP) cells (Fig. 3c ). Strikingly, expression of IL-4–GFP solely by thymic hematopoietic cells in the IL-4–GFP + Jedi-TCRαβ → WT group or by radioresistant cells in the WT + Jedi-TCRαβ → IL-4–GFP group in both cases resulted in a virtually complete elimination of GFP-specific CD8SP thymocytes (Fig. 3c ). Residual DP thymocytes in chimeras with IL-4–GFP donors and/or recipients upregulated PD-1 expression and contained a large fraction of dying cells (Fig. 3c ) and cells positive for active caspase-3 (Fig. 3d ), indicating that these autoreactive cells were eliminated by negative selection. Strikingly, in IL-4–GFP + Jedi-TCRαβ → WT chimeras, this elimination of autoreactive thymocytes was mediated by as few as 0.1 ± 0.02% of GFP + hematopoietic cells present in the thymi of these mice (Extended Data Fig. 2e ). By contrast, WT + Jedi-TCRαβ → IL-4–GFP chimeras contained, on average, 0.01% of residual GFP + hematopoietic cells, and some had virtually no detectable GFP + thymocytes, indicating that, in this setting, induction of tolerance is likely to be mediated solely by thymic stroma (Extended Data Fig. 2e ). The disappearance of Jedi CD8 + thymocytes was reflected in the periphery by an overall decrease in Jedi-TCRαβ cells and a near complete loss of GFP-specific conventional CD8 + T cells in the spleen (Fig. 3e ). As the TCR in Jedi-TCRαβ mice was expressed prematurely at the DN stages of T cell development (Fig. 3c ), we performed a similar analysis with Jedi-TCRβ mice that only carry the TCRβ chain of the Jedi TCR and thus rely on recombination of the endogenous Tcra loci at the DP stage of T cell development. A small distinct population of Jedi-TCRβ GFP-specific CD8 + T cells was completely eliminated in the presence of antigen (see Supplementary Note 1 and Supplementary Figs. 1 and 2 ). We conclude that most CD8 + T cells that recognize IL-4–GFP are inactivated already in the thymus, and TECs and hematopoietic cells play redundant roles in the induction of central tolerance to this inflammation-associated self-antigen.

iNKT cells and eosinophils can mediate negative selection

As the thymic GFP + population in IL-4–GFP mice, although dominated by innate-like T lymphocytes, represent a complex mix of cells (Fig. 3a ), we next aimed to test if antigen expression solely by innate-like T cells was sufficient to induce tolerance. To this end, we established reaggregate thymus organ cultures (RTOCs; Fig. 4a ) with small numbers of Jedi DP thymocytes and iNKT cells sorted from WT or IL-4–GFP thymi. The presence of as few as 0.2% of GFP + iNKT cells in these thymus organoids resulted in a near complete deletion of Jedi cells with few remaining cells acquiring the CD4 – CD8α lo CD8β lo PD-1 hi cell-surface phenotype (Fig. 4b ). Thus, antigen expression by minute numbers of innate-like T cells is sufficient to eliminate autoreactive thymocytes in the RTOC system.

a , Schematic representation of the RTOC experiments shown in b – d . Jedi-TCRαβ and OT-I DP thymocytes were sorted as CD4 + CD8 + cells, and ex vivo iNKT cells were sorted from the thymi of WT and IL-4–GFP mice as CD1d tetramer-binding cells (without additional gating on GFP). Transduced thymic iNKT cells were sorted as Thy1.1 + ( c ) or GFP + ( d ) CD1d tetramer-binding cells; E14.5–15.5, embryonic days 14.5–15.5. b , Flow cytometric analysis of RTOCs with ex vivo thymic WT or IL-4–GFP iNKT cells 5 days after initiation of reaggregation. Representative plots show the distribution of Jedi cells (CD45.1 + ), iNKT cells (CD45.2 + ) and fetal thymocytes (CD45.1 + CD45.2 + ), frequencies of GFP-expressing cells, frequencies of H2-K d GFP 200–208 tetramer-binding Jedi thymocytes (quantification is shown on the right) and expression of the indicated cell-surface markers by the latter cells. Results are pooled from three independent experiments ( n  = 4 RTOCs for WT iNKT cells and n  = 7 for IL-4–GFP iNKT cells). c , Thymic iNKT cells were transduced with Thy1.1-IRES-i.c.GFP, Thy1.1-IRES-secGFP or Thy1.1-only retroviruses. Sorted Thy1.1 + iNKT cells were added to RTOCs together with Jedi-TCRαβ DP thymocytes. Flow cytometric analysis and quantification is shown as in b ( n  = 5 RTOCs for empty vector, n  = 10 for i.c.GFP and n  = 9 for secGFP). Results are pooled from two independent experiments. d , Thymic iNKT cells were transduced with cOVA-IRES-GFP retroviruses encoding the indicated versions of the OVA 257–264 epitope. Sorted GFP + iNKT cells were added to RTOCs together with OT-I DP thymocytes. RTOCs with nontransduced iNKT cells were used as a no-antigen control. Flow cytometric analysis and quantification is shown as in b ( n  = 6 RTOCs for uninfected, n  = 3 for N4, n  = 6 for Q4, n  = 3 for T4 and n  = 5 for V4). Representative results from two independent experiments are shown. Data are presented as mean ± s.d. (* P  < 0.05, ** P  < 0.01, *** P  < 0.001 and **** P  < 0.0001) and were analyzed by two-tailed Student’s t -test ( b ) or one-way ANOVA with a Holm–Sidak multiple comparisons test ( c and d ).

Of note, this highly efficient induction of negative selection was not a unique property of iNKT cells, as small numbers of conventional ACTB–GFP-transgenic CD4SP thymocytes and thymic eosinophils from IL-4–GFP mice likewise induced elimination of Jedi-TCRαβ DP thymocytes in RTOCs (Extended Data Fig. 3a–c ). These results suggest that in addition to professional thymic APCs, such as TECs, negative selection of autoreactive CD8 + thymocytes can be induced by expression of antigen in a wide range of ‘amateur’ APC cell types, including developing conventional T lymphocytes, thymic innate-like T cells and thymic eosinophils.

Effects of co-stimulation, antigen localization and affinity

As co-stimulation by CD80/CD86 can be important for effective negative selection for some, but not all, TCR specificities 45 , 46 , 47 , 48 , 49 , we next assessed the expression of these molecules by thymic eosinophils and innate-like T cells (Extended Data Fig. 4a ). Thymic eosinophils expressed high levels of CD80 but not CD86, whereas a large fraction of thymic iNKT cells and some γδT cells displayed both co-stimulatory molecules on their surface. As data from the Immgen database 20 , 34 suggest that iNKT cells express little if any Cd80 or Cd86 mRNA, and as T cells often acquire CD80 and CD86 from APCs through trogocytosis 50 , 51 , it seems likely that iNKT cells acquire these molecules from professional thymic APCs. Addition of anti-CD80/CD86 to RTOCs containing Jedi-TCRαβ DP thymocytes and WT or IL-4–GFP iNKT cells had no effect on negative selection (Extended Data Fig. 4b ), suggesting that co-stimulation might be dispensable for negative selection in the case of Jedi thymocytes. However, as the co-stimulation requirement for negative selection is not absolute and depends on the epitope 45 , and as thymic innate-like T cells are equipped with CD80 and CD86, it is conceivable that co-stimulation could contribute to the induction of tolerance to some self-antigens expressed by these cells.

As many endogenous inflammation-associated self-antigens are secreted molecules, we next tested if innate-like T cells can induce tolerance to a secreted antigen. To this end, we generated retroviral constructs encoding intracellular (i.c.GFP) and secreted (secGFP) versions of GFP and confirmed efficient GFP secretion in the latter setting (Extended Data Fig. 4c ). We next transduced thymic iNKT cells with Thy1.1-IRES-i.c.GFP, Thy1.1-IRES-secGFP and Thy1.1-only retroviruses, sorted Thy1.1 + iNKT cells and added them to RTOCs together with Jedi-TCRαβ DP thymocytes. A comparable loss of Jedi cells was observed with i.c.GFP and secGFP constructs, and the remaining cells upregulated PD-1 expression and downregulated CD8 expression (Fig. 4c ).

Finally, to test how antigen affinity affects negative selection, we took advantage of altered peptide ligands described for the OT-I TCR. It was shown that Q4, T4 and V4 substitutions in the SIINFEKL epitope (N4) reduced OT-I CD8 + T cell reactivity by 20-, 70- and 700-fold, respectively 52 . We therefore retrovirally transduced thymic iNKT cells with constructs encoding cytoplasmic ovalbumin (cOVA)-IRES-GFP containing these epitopes and added GFP + iNKT cells to RTOCs together with sorted OT-I DP thymocytes. N4-, Q4- and T4-expressing iNKT cells induced a near complete elimination of OT-I thymocytes (33-, 18- and 9-fold decreases, respectively), and even very low-affinity V4 epitope was sufficient to induce elimination of about half of the OT-I thymocytes (Fig. 4d ).

We conclude that expression of either intracellular or secreted antigens by innate-like T cells can be sufficient to induce elimination of autoreactive CD8 + thymocytes and that this elimination can take place across a wide range of affinities.

Antigen expression by iNKT cells induces tolerance in vivo

We next sought to test if antigen expression by innate-like T cells is also sufficient to mediate tolerance induction in vivo. As a first approach to this question, we used IL-17A–GFP mice in which, in contrast to the IL-4–GFP system, GFP expression in the thymic hematopoietic compartment was restricted to innate and innate-like lymphocytes (Fig. 5a and Extended Data Fig. 5a,b ). Analysis of stromal populations in these mice also revealed GFP expression in a small subset of mTECs (Extended Data Fig. 5c ). Therefore, to dissect the roles of GFP-expressing stromal and hematopoietic populations, we established WT → WT, IL-17A–GFP → WT, WT → IL-17A–GFP and IL-17A–GFP → IL-17A–GFP BM chimeras and immunized these mice with the GFP 200–208 peptide. Fully mirroring the results obtained in the IL-4–GFP system (Fig. 2 ), IL-17A–GFP expression either by radioresistant or radiosensitive cells was sufficient to abrogate CD8 + T cell responses to GFP 200–208 (Fig. 5b ), whereas no CD4 + T cell tolerance to GFP 81–95 MHC class II epitope immunization was observed in IL-17A–GFP mice (Extended Data Fig. 5d ). Unexpectedly, GFP-expressing cells were very poorly reconstituted in the thymi of IL-17A–GFP → WT BM chimeras (0.009 ± 0.003% GFP + cells of total thymocytes in IL-17A–GFP → WT BM chimeras versus 0.06 ± 0.04% in steady-state IL-17A–GFP mice and 0.5 ± 0.2% in IL-4–GFP mice; Extended Data Fig. 5e ). This near absence of GFP-expressing cells in the thymi of IL-17A–GFP BM chimeras precluded us from assessing negative selection of supraphysiological numbers of autoreactive GFP-specific thymocytes in Jedi:IL-17A–GFP mixed BM chimeras, a setting that in fact resulted in breach of tolerance (see below). As an alternative approach, we therefore turned to RTOC experiments, which demonstrated that iNKT cells from IL-17A–GFP mice can induce efficient elimination of Jedi-TCRαβ DP thymocytes (Fig. 5c ).

a , GFP expression by thymic nonstromal populations in IL-17A–GFP mice (as in Fig. 3a ; n  = 5 mice). See also Extended Data Fig. 5a–c ; MAIT, mucosal-associated invariant T. b , Reciprocal BM chimeras were established and immunized with GFP 200–208 peptide as in Fig. 2c but using IL-17A–GFP donor and recipients (all mice were on a CB6F1 background). WT mice were used as an unimmunized control. Tetramer binding by CD8 + CD44 + T cells, frequencies of CD8 + CD44 + tetramer + cells from total CD8 + T cells and their absolute numbers are shown. Results were pooled from two independent experiments (WT → WT and IL-17A–GFP → WT groups) or from one experiment (the rest; n  = 4 mice for nonimmunized, n  = 8 for WT → WT, n  = 11 for IL-17A–GFP → WT, n  = 3 for WT → IL-17A–GFP and n  = 3 for IL-17A–GFP → IL-17A–GFP). c , RTOCs with sorted Jedi DP thymocytes and thymic iNKT cells were established and analyzed as in Fig. 4b but using IL-17A–GFP iNKT cells (sorted as CD1d tetramer-binding cells (without gating on GFP); n  = 2 RTOCs for WT iNKT cells and n  = 3 for IL-17A–GFP iNKT cells). Representative results of three independent experiments are shown. d , Jedi-TCRβ mice were injected intrathymically (i.t.) with iNKT cells sorted from the thymi of IL-4–GFP mice (both donor and recipient mice were on a BALB/c background). Thymi of the injected mice were analyzed 7 days later. Uninjected Jedi-TCRβ mice were used as controls. Representative plots show frequencies of GFP-expressing cells, frequencies of H2-K d GFP 200–208 tetramer-binding Jedi thymocytes and expression of the indicated cell-surface markers by the latter cells. Quantification of the frequencies of all tetramer-binding cells of total thymocytes, CD8α + CD8β + tetramer-binding cells of total thymocytes and CD8α + CD8β + cells of tetramer-binding cells are shown. Results are pooled from three intrathymic injection experiments ( n  = 8 lobes for the uninjected group and n  = 6 lobes for the IL-4–GFP group; 2 lobes from the uninjected group were not stained for CD8 expression). Data are presented as mean ± s.d. (* P  < 0.05, *** P  < 0.001 and **** P  < 0.0001) and were analyzed by two-tailed Student’s t -test ( d ) or one-way ANOVA with a Holm–Sidak multiple comparisons test ( b ).

The immunization experiments in IL-17A–GFP → WT BM chimeras described above showed that expression of a model inflammation-associated self-antigen solely by innate-like lymphocytes is sufficient to induce tolerance in vivo, and RTOC experiments suggested that it can happen through negative selection of autoreactive thymocytes. To directly test if exclusive antigen expression by thymic innate-like T cells is sufficient to induce inactivation of autoreactive CD8 + thymocytes in vivo, we injected sorted thymic IL-4–GFP iNKT cells into the thymi of Jedi-TCRβ mice, which, before injection, contained 0.007 ± 0.003% GFP-specific thymocytes (Fig. 5d ). GFP + cells were detectable in the thymi of the recipient mice 7 days after transfer (Fig. 5d ), but their frequency was much lower than that in IL-4–GFP mice (Fig. 3a ) and similar to what was observed in steady-state IL-17A–GFP mice (Fig. 5a ). The presence of these minute numbers of GFP + iNKT cells resulted in a decreased frequency of GFP-specific thymocytes and an acquisition of a CD4 – CD8α lo CD8β lo PD-1 hi cell-surface phenotype by the remaining GFP-specific cells (Fig. 5d ). Thus, antigen expression exclusively by small numbers of thymic innate-like T cells is sufficient to induce elimination of autoreactive CD8 + thymocytes in vivo.

T cell-to-T cell antigen presentation mediates negative selection

The efficient negative selection of autoreactive thymocytes by small numbers of antigen-expressing innate-like T cells suggested possible cross-presentation by thymic professional APCs. To start exploring this possibility, we sorted DCs, iNKT cells and eosinophils from the thymi of WT, IL-4–GFP and IL-17A–GFP mice and cocultured them with an NFAT reporter cell line 53 expressing the Jedi TCR. Reporter expression was upregulated in cocultures with iNKT cells from IL-4–GFP and IL-17A–GFP mice and eosinophils from IL-4–GFP mice but not in cocultures with DCs (Extended Data Fig. 6a , note the higher baseline reporter expression in all DC cocultures), suggesting that IL-4–GFP and IL-17A–GFP may not undergo efficient cross-presentation by thymic DCs.

To directly test if cross-presentation could contribute to negative selection, we studied the fate of Jedi-TCRαβ DP thymocytes in RTOCs established with iNKT cells sorted from the thymi of IL-4–GFP mice either on an H2 b/d background (capable of presentation to Jedi thymocytes) or on an H2 b/b background that makes direct presentation to Jedi thymocytes impossible. Negative selection and phenotypic changes of Jedi cells were completely abrogated when iNKT cells were unable to directly present the GFP peptide to Jedi thymocytes due to this MHC mismatch, even when such iNKT cells were present at highly supraphysiological numbers (Fig. 6a ). No evidence for cross-presentation was obtained when MHC-mismatched iNKT cells from IL-17A–GFP mice or MHC-mismatched iNKT cells expressing a secreted version of GFP were used in RTOC experiments (Extended Data Fig. 6b,c ).

a , RTOCs with sorted Jedi-TCRαβ DP thymocytes and iNKT cells were established and analyzed as in Fig. 4b but using iNKT cells sorted from WT mice (H2 b/d background) or IL-4–GFP mice on H2 b/d and H2 b/b backgrounds. Results from one experiment ( n  = 2 RTOCs per group) are shown. b , CB6F1 WT recipient mice (H2 b/d ) were irradiated and transferred intravenously (i.v.) with a mix of BM cells from Jedi-TCRβ mice on a CB6F1 background (H2 b/d ) and WT H2 b/d , IL-4–GFP H2 b/d or IL-4–GFP H2 b/b mice (on mixed C57BL/6J and BALB/c genetic backgrounds). Thymi of chimeras were analyzed 6 weeks after reconstitution. Representative plots demonstrate the frequencies of GFP-expressing thymocytes, frequencies of H2-K d GFP 200–208 tetramer-binding thymocytes (quantification shown on the right side) and expression of the indicated cell-surface markers by the latter cells ( n  = 3 chimeras per group). Data are representative of two independent experiments. c , Schematic representation of RTOC experiments shown in d – g ; O/N, overnight. d – g , Confocal microscopy analysis of RTOCs assembled with sorted Jedi-TCRαβ DP thymocytes (labeled with CellTrace Violet (CTV) and Cal-520 AM Ca 2+ sensor dye) and thymic GFP + iNKT cells from IL-4–GFP mice or total iNKT cells from WT thymi (labeled with CellTrace Yellow (CTY)). d , Representative images showing interactions between Jedi thymocytes and IL-4–GFP iNKT cells (top and middle) and a WT iNKT cell (bottom); scale bars, 2 µm. e , Quantification of Ca 2+ signaling events in Jedi thymocytes contacting WT or IL-4–GFP iNKT cells. The numbers in the circles indicate the total number of interactions analyzed. f , Normalized Ca 2+ signaling intensity in Jedi thymocytes interacting with iNKT cells. Quantification was performed as described in the Methods . Mean and 95% confidence interval are shown ( n  = 10 Jedi cells per group). Individual curves for each cell are shown in Extended Data Fig. 6g . g , Quantification of the interaction time with iNKT cells for 90 Jedi thymocytes from RTOCs with WT iNKT cells (gray), 35 Jedi cells that underwent Ca 2+ flux in RTOCs with IL-4–GFP iNKT cells (orange) and 44 Jedi cells that did not undergo Ca 2+ flux in RTOCs with IL-4–GFP iNKT cells (blue). Data are presented as mean ± s.d. (** P  < 0.01, *** P  < 0.001 and **** P  < 0.0001) and were analyzed by one-way ANOVA with a Holm–Sidak multiple comparisons test ( b ) or Kruskal–Wallis test ( g ).

To assess the contribution of direct versus cross-presentation of IL-4–GFP in vivo, we next established three groups of BM chimeras: (1) WT H2 b/d  + Jedi-TCRβ H2 b/d  → WT H2 b/d (no antigen), (2) IL-4–GFP H2 b/d  + Jedi-TCRβ H2 b/d  → WT H2 b/d (both direct and cross-presentation is possible) and (3) IL-4–GFP H2 b/b  + Jedi-TCRβ H2 b/d  → WT H2 b/d (only cross-presentation by APCs of Jedi and recipient origin is possible). Importantly, in the latter setting, more than half of the thymic DCs expressed H2-K d (Extended Data Fig. 6d ) and therefore were theoretically capable of cross-presentation of GFP 200–208 epitope to Jedi cells. Although GFP-specific thymocytes were eliminated when direct presentation was possible, ‘direct presentation-deficient’ IL-4–GFP H2 b/b  + Jedi-TCRβ H2 b/d  → WT chimeras had numbers and cell-surface phenotypes of GFP-specific thymocytes indistinguishable from those of the no-antigen group (Fig. 6b ). Finally, intrathymic injections of H2 b/b (no direct presentation) or H2 b/d (direct presentation is possible) iNKT cells expressing a secreted version of GFP into Jedi-TCRβ H2 b/d recipients demonstrated that PD-1 upregulation and CD8 + downregulation was evident only when transferred iNKT cells were capable of direct antigen presentation (Extended Data Fig. 6e ). We conclude that in the case of GFP as an innate-like T cell-derived model antigen, it undergoes direct T cell-to-T cell presentation but not cross-presentation by thymic APCs.

Finally, to visualize these T cell-to-T cell antigen presentation events, we analyzed the interactions between fluorescently labeled iNKT cells and Jedi-TCRαβ thymocytes loaded with Calbryte-520 (Cal-520) AM Ca 2+ sensor dye in RTOCs by confocal microscopy. Jedi DP cells for these experiments were sorted for low levels of PD-1 expression to enrich TCR-expressing cells (Extended Data Fig. 6f ). RTOCs were allowed to assemble overnight and were then imaged by confocal microscopy for 13 h (Fig. 6c–g ). Both iNKT cells and viable Jedi-TCRαβ DP thymocytes were highly motile in these organoids (Supplementary Videos 1 – 4 ). In line with the expression of the Jedi TCR by about 70% of DP thymocytes at the beginning of the culture and their ongoing negative selection, approximately one-third of the contacts between Jedi thymocytes and IL-4–GFP iNKT cells resulted in Ca 2+ flux in Jedi-TCRαβ DP cells (Fig. 6d–f , Extended Data Fig. 6g and Supplementary Video 1 ). No such contact-induced Ca 2+ signaling was observed in RTOCs with WT iNKT cells (Fig. 6d–f and Supplementary Video 2 ). Contacts between IL-4–GFP iNKT cells and Jedi-TCRαβ DP cells that lead to Ca 2+ signaling were longer than those that did not result in Ca 2+ flux (Fig. 6g ), and, in some cases, Jedi thymocytes exhibited chasing behavior toward IL-4–GFP iNKT cells (Supplementary Video 3 ). In few cases, contact-induced Ca 2+ flux in Jedi-TCRαβ thymocytes was followed by a loss of motility and changes in cellular morphology suggestive of cell death (Supplementary Video 4 ). Thus, direct antigen presentation by iNKT cells to autoreactive thymocytes was confirmed by visualization of TCR signaling in autoreactive CD8 + thymocytes.

Lack of tolerance to IL-17A–GFP results in a fratricide reaction

We next sought to investigate the consequences of failure to disarm CD8 + T cells reactive to an antigen expressed by effector T cells. Our initial analysis of PLZF lu/lu and Tcrd –/– Cd1d –/– Mr1 –/– mice, which lack some innate-like T cell populations, did not reveal autoimmune phenotypes, in line with the unexpected abundance of all functional effector subsets in the thymi of these mice (see Supplementary Note 2 and Supplementary Figs. 3 and 4 ). We therefore next decided to take advantage of the fact that the thymic IL-17A–GFP + compartment was not properly reconstituted in IL-17A–GFP → WT BM chimeras, and GFP + cells were nearly absent in the thymi of these mice, whereas the peripheral IL-17A–GFP effector subsets were less affected in this setting (Extended Data Figs. 5e and 7a ). We hypothesized that if we tip the balance between scarce thymic IL-17A–GFP + cells and developing GFP-specific CD8 + thymocytes toward the latter cells in this system, some autoreactive CD8 + T cells should escape to the periphery and may cause autoimmune elimination of peripheral T H 17 cells. To test this hypothesis, we established the following three groups of BM chimeras: (1) IL-17A–GFP → WT (no overproduction of autoreactive T cells), (2) WT + Jedi-TCRβ → WT (no antigen) and (3) IL-17A–GFP + Jedi-TCRβ → WT (predominantly peripheral antigen and overproduction of autoreactive T cells; Fig. 7a ). As expected, small numbers of GFP-specific CD8 + T cells with naive cell-surface phenotype were found in peripheral lymphoid organs of WT + Jedi-TCRβ → WT chimeras (Fig. 7b and Extended Data Fig. 7b ). By contrast, lymphoid organs of IL-17A–GFP + Jedi-TCRβ → WT chimeras contained strongly expanded GFP-specific CD8 + T cells with a CD44 + PD-1 + activated cell-surface phenotype (Fig. 7b and Extended Data Fig. 7b ). Thymi of IL-17A–GFP + Jedi-TCRβ → WT BM chimeras also exhibited an accumulation of GFP-specific CD44 + PD-1 + CD8 + T cells (Extended Data Fig. 7c ), possibly reflecting recruitment of activated cells from the periphery. Of note, this was in stark contrast to the previous observations made in IL-4-GFP + Jedi-TCRβ → WT BM chimera thymi that exhibited a complete loss of GFP-specific cells (Fig. 6b and Supplementary Fig. 2 ). This accumulation of activated autoreactive CD8 + effector T cells coincided with a near complete loss of IL-17A–GFP + T H 17 cells (Fig. 7c and Extended Data Fig. 7d,e ; gating on V β 4 – cells was applied to exclude Jedi cells from the analysis). These results suggest that breach in tolerance induction results in an autoimmune attack that may eliminate peripheral IL-17A-expressing effector T cells. To formally test this, we performed an in vivo killing assay by transferring T H 17 cells in vitro differentiated from CD4 + T cells of IL-17A–GFP mice. Only a fraction of these cells induced the expression of GFP (which correlated well with the production of IL-17A; Extended Data Fig. 7f ) and therefore would represent possible targets for activated Jedi cells. These GFP + cells were selectively eliminated in IL-17A–GFP + Jedi-TCRβ → WT, but not in WT + Jedi-TCRβ → WT, chimeras (Fig. 7d ). Together, these results demonstrate that failure to induce CD8 + T cell tolerance to a single inflammation-associated self-antigen can result in a fratricide reaction that leads to elimination of the entire class of effector T cells expressing this molecule.

a , Schematic representation of experiments shown in b – d . WT recipient mice were irradiated and transferred i.v. with T cell- and NK cell-depleted BM cells from IL-17A–GFP mice or Jedi-TCRβ mice and WT mice or Jedi-TCRβ mice and IL-17A–GFP mice (all on a CB6F1 background). Spleens were analyzed 8 weeks after reconstitution. Note the near absence of thymic IL-17A–GFP-expressing cells in BM chimeras (see Extended Data Fig. 7a ). b , Frequency and cell-surface phenotype of H2-K d GFP 200–208 tetramer-binding CD8 + T cells in the spleens of BM chimeras. c , Frequency of IL-17A–GFP-expressing cells among total lymphocytes and V β 4 – (non-Jedi) CD4 + T cells. d , Twenty hours before collection, CTV-labeled T H 17 cells in vitro differentiated from IL-17A–GFP CD4 + T cells were i.v. transferred into the indicated groups of chimeras. Elimination of the GFP hi fraction of CTV + cells was assessed by flow cytometry. Representative results of two independent experiments ( b and c ) or one experiment ( d ; n  = 3 chimeras per group) are shown. Data are presented as mean ± s.d. (* P  < 0.05, *** P  < 0.001 and **** P  < 0.0001) and were analyzed by two-tailed Student’s t -tests.

Induction of tolerance to an endogenous effector molecule

Finally, we sought to test if expression of an endogenous effector T cell molecule exclusively in the hematopoietic compartment is sufficient to induce CD8 + T cell tolerance to this antigen. We focused on IFNγ, the production of which among thymocytes was restricted to T cell/NK cell/innate lymphoid cell (ILC) lineages, as evidenced by Thy1 and NK1.1 expression and lack of MHC class II expression by IFNγ + cells (Extended Data Fig. 8a ). We identified an H2-K b epitope in IFNγ (IFNγ 69–78 QIISFYLRLF), the immunization of which resulted in a strong CD8 + T cell response in Ifng –/– , but not WT, animals (Extended Data Fig. 8b ). We next established the following four groups of BM chimeras: (1) WT → WT, (2) Ifng –/–  → WT, (3) WT →  Ifng –/– and (4) Ifng –/–  →  Ifng –/– and immunized them with IFNγ 69–78 and an irrelevant foreign peptide (ovalbumin (OVA 257–264 ) SIINFEKL). Intracellular staining for tumor necrosis factor (TNF) after a brief peptide restimulation was used as a readout for antigen-specific CD8 + T cell responses. All four groups of chimeras showed a response to the foreign epitope immunization (Extended Data Fig. 8c ). By contrast, only Ifng –/–  →  Ifng –/– chimeras exhibited a strong response to IFNγ 69–78 immunization, whereas all other groups of chimeras were equally tolerant to this epitope (Fig. 8 ). Thus, expression of IFNγ solely by hematopoietic cells can induce CD8 + T cell tolerance to this molecule. Together with the T cell/NK cell/ILC-restricted expression, these results suggest that antigen expression by these effector subsets is sufficient for induction of tolerance to this endogenous inflammation-associated self-antigen.

WT and Ifng –/– mice on a C57BL/6J background were lethally irradiated and reconstituted with syngeneic WT or Ifng –/– BM cells depleted of T and NK cells. Eleven weeks after reconstitution, the resulting four groups of BM chimeras were immunized with IFNγ 69–78 and OVA 257–264 peptides using anti-CD40 and poly(I:C) as adjuvant (see also Extended Data Fig. 8c ). For quantification of antigen-specific CD8 + T cell responses, splenocytes were isolated 6 days after immunization and stimulated with IFNγ 69–78 peptide for 6 h ( Methods ). Production of TNF by CD8 + T cells was analyzed by flow cytometry ( n  = 5 for WT →  Ifng –/– and n  = 4 for the other groups). Data are presented as mean ± s.d. (** P  < 0.01) and were analyzed by one-way ANOVA with a Holm–Sidak multiple comparisons test. Data are representative of two independent experiments.

Self/non-self discrimination by the adaptive immune system largely relies on the context of antigen encounter. For T lymphocytes, a variety of tolerance mechanisms ensure inactivation of autoreactive cells in the thymus or in the periphery in the absence of inflammation induced by pathogen invasion. Only if a mature T lymphocyte encounters an antigen in the context of inflammation does it receive all signals required to induce clonal expansion and execution of effector programs. The expression of numerous self-molecules involved in T cell effector programs therefore overlaps in time and space with the emergence of pathogen-derived antigens. In this study, we aimed to investigate how the immune system distinguishes such inflammation-associated self-antigens from pathogen-derived molecules. We demonstrated that CD8 + T cell tolerance to inflammation-associated self-antigens can be induced in the thymus through antigen presentation by a variety of thymic cell types. These include two cell types not previously implicated in T cell tolerance induction—thymus-resident innate-like T cells and thymic eosinophils. We showed that minute numbers of thymic innate-like T lymphocytes, cells that express self-antigens characteristic of all major T cell effector programs, were sufficient to efficiently eliminate autoreactive CD8 + thymocytes. We demonstrated that CD8 + T cell tolerance induction by innate-like T lymphocytes can be achieved without the involvement of professional APCs through direct T cell-to-T cell antigen presentation. We also provided evidence for the contribution of effector lymphocytes to the induction of tolerance to an endogenous inflammation-associated self-antigen. Finally, we showed that decreased abundance of a model inflammation-associated self-antigen in the thymus can result in a spontaneous fratricide reaction, causing complete elimination of peripheral effector T cell subsets expressing this antigen.

This unprovoked and extremely efficient elimination of a whole class of effector T cells after breach of tolerance to a single inflammation-associated self-antigen highlights the ultimate importance of tolerance to this group of molecules. The importance of this tolerance seems to be further reflected by the high redundancy of cell types that express such antigens in the thymus. Such redundant expression was also characteristic for IFNγ that was expressed by thymic innate and innate-like lymphocytes and a small group of TECs. Well in line with our observations with model antigens, both radioresistant and radiosensitive cells were able to mediate CD8 + T cell tolerance to this endogenous inflammation-associated self-antigen. Together with the T cell/NK cell/ILC-restricted expression of IFNγ in the hematopoietic compartment, these results provide evidence for the role of effector lymphocytes in the induction of tolerance to this proinflammatory cytokine. Although by themselves these experiments cannot discriminate between central and peripheral tolerance mechanisms, the abundance of IFNγ-expressing cells in the thymus and our results obtained with model antigens suggest that central tolerance is likely to contribute to the neutralization of IFNγ-reactive CD8 + T cells.

Although cytotoxic responses to inflammation-associated molecules have not, to our knowledge, been studied in the context of autoimmunity, many human autoimmune diseases are associated with autoantibodies against a broad range of proinflammatory cytokines 54 , suggesting that CD4 + T cell tolerance to these self-antigens is broken in such patients. Interestingly, in our study using IL-4–GFP and IL-17A–GFP as model inflammation-associated self-antigens, we observed profound CD8 + , but not CD4 + , T cell tolerance. We also did not find any evidence of GFP cross-presentation by thymic DCs in this system, even when innate-like T cells expressed a secreted form of GFP. However, we did not test if secreted GFP may be subjected to MHC class II presentation by professional APCs. Moreover, the situation may be different for some endogenous secreted antigens, for example, if professional thymic APCs would express a receptor for such a molecule. It remains to be investigated if in these scenarios secreted inflammation-associated self-antigens would be taken up and presented by DCs, enabling the induction of CD4 + T cell tolerance. Alternatively, it is also possible that induction of CD4 + T cell tolerance is less stringent for inflammation-associated self-antigens, making them frequent targets in autoimmunity. Finally, unlike their mouse counterparts, human thymocytes can express MHC class II molecules 55 , and the expression of genes encoding MHC class II chains was relatively high in some of the thymocyte populations that expressed T cell effector genes (Extended Data Fig. 1 ). It is therefore conceivable that in humans, these cells could also present antigens to developing CD4 + thymocytes and therefore contribute to the induction of CD4 + T cell tolerance.

Although the role of direct antigen presentation by professional APCs in the elimination of autoreactive thymocytes is well documented 8 , 10 , the contribution of antigen presentation by nonprofessional APCs to this process under physiological circumstances remained unclear. In in vitro systems, peptide-pulsed thymocytes are capable of direct antigen presentation and induction of cell death in autoreactive thymocytes 56 , 57 . In an in vivo setting, mature T cells were shown to mediate the induction of central tolerance to an alloantigen 58 . In addition, it was demonstrated that autoantigens expressed by T cells 59 and thymic fibroblasts 60 can contribute to the induction of T cell tolerance. However, it remains unclear if the latter happens through direct antigen presentation of autoantigens or through their cross-presentation by professional APCs.

In this study, we have demonstrated that endogenous antigen expression by minute numbers of thymic-resident innate-like T cells, thymic eosinophils and conventional developing thymocytes was sufficient to eliminate autoreactive CD8 + thymocytes. Moreover, we demonstrated that innate-like T cells can induce CD8 + T cell tolerance by directly presenting self-antigens to autoreactive thymocytes. These results substantially expand the array of known cell types that can mediate the induction of T cell tolerance and suggest that most cell types that express MHC class I and are present in the thymus are likely able to contribute to the induction of CD8 + T cell tolerance. In addition to B cells and eosinophils, mouse and/or human thymi were reported to harbor several NK cell and ILC subsets, plasma cells, mast cells, erythroblasts, megakaryocytes and recirculating memory T cells 35 , 61 , 62 , 63 . Thus, in addition to ectopic antigen expression by mTECs, recruitment and/or retention of these ‘ectopic cell types’ may represent a mechanism that ensures representation of hematopoietic system-derived self-antigens in the thymus.

Recent studies have demonstrated that large fractions of iNKT cells and γδT cells in the thymus are tissue-resident cells 23 , 24 . Moreover, thymus-resident innate-like T cells are in the center of a complex ‘ecosystem’ that actively ensures their presence in the thymus and production of inflammatory mediators by these cells. Indeed, a tuft cell-like subset of mTECs is required for iNKT cell accumulation in the thymus 5 , whereas production of IL-4 by these cells is ensured by their CD1d-dependent activation by thymic myeloid cells 64 . In turn, type 2 cytokines secreted by iNKT cells support the intrathymic generation of IFNγ-producing CD8 + T cells 25 , 26 , regulate the recruitment of thymic eosinophils 27 and induce the activation thymic DCs 29 . In addition, proinflammatory cytokines of both stromal (type 1 IFNs, IL-15, IL-6 and thymic stromal lymphopoetin) and innate-like T cell (IFNγ) origin were shown to regulate thymic T cell development 65 , 66 , indicating that these mediators are present in the thymic microenvironment in biologically meaningful amounts. Moreover, several inflammatory pathways, including type 1/type 3 IFN signaling and Toll-like receptor and/or IL-1β signaling, are constitutively active in TECs 30 , 31 .

In this study, we demonstrated that at least two cellular components of this inflammatory network (thymic innate-like T cells and eosinophils) were sufficient to mediate the induction of remarkably efficient tolerance to antigens that they express. Taking these observations together, it is tempting to speculate that constitutive activation of a plethora of inflammatory pathways in the thymus may have evolved to ensure induction of tolerance to inflammation-associated self-antigens, a class of molecules that otherwise largely mirror the spatial and temporal distribution of pathogen-derived antigens.

IL-4–GFP 41 , IL-17A–GFP and Ifng –/– 67 mice were purchased from the Jackson Laboratory. Rag2 –/– mice were purchased from Janvier Labs. PLZF lu/lu 68 , OT-I 69 , ACTB–GFP 70 , Jedi-TCRαβ 44 and Tcrd –/– Cd1d –/– Mr1 –/– 71 mice were described previously. WT C57BL/6J and BALB/c mice were obtained from Janvier Labs or were bred in-house. Jedi-TCRβ-only mice were generated from Jedi-TCRαβ mice by crossing with WT BALB/c mice and were further backcrossed to the BALB/c background for more than ten generations. WT C57BL/6J × BALB/c F1 mice (referred to as CB6F1), IL-4–GFP CB6F1, IL-17A–GFP CB6F1, ACTB–GFP CB6F1 and Jedi-TCRβ CB6F1 mice were generated by crossing mice on C57BL/6J and BALB/c backgrounds. For MHC mismatch experiments, IL-4–GFP CB6F1 mice were crossed with WT C57BL/6J mice to generate IL-4–GFP H2 b/d and IL-4–GFP H2 b/b mice. Tcrd –/– Cd1d –/– Mr1 –/– mice were bred and maintained at the Würzburg Institute for Systems Immunology. All other mice were bred and maintained at the Comparative Medicine Biomedicum facility of Karolinska Institutet (Stockholm, Sweden) and were kept under specific pathogen-free conditions. All mouse experiments were performed according to valid ethical permits, which were approved and regularly controlled by the Swedish and/or German Veterinary Authority.

Flow cytometry

Mouse spleen tissue, lymph nodes and thymi were collected, and single-cell suspensions were obtained by mincing through 70-μm cell strainers. Isolation of intestinal intraepithelial lymphocytes (iIELs) was performed as described previously 72 . Isolation of TECs was performed as described previously 73 with minor modifications. In short, each thymus was digested in 0.5–1 ml of RPMI 1640 medium with 1 mg ml –1 collagenase IV and 100 U ml –1 DNase I for 20 min at 37 °C before staining with APC-labeled anti-EPCAM, followed by enrichment using anti-APC microbeads (Miltenyi Biotec) and magnets from the EasySep Cell Isolation and Separation Technology platform (STEMCELL Technologies). For detection of antigen-specific T cells, single-cell suspensions were incubated with APC- and/or PE-conjugated H2-K d GFP 200–208 or I-A b GFP 81–95 , PE- or BV421-conjugated CD1d-PBS-57 or APC-conjugated MR1-5-OP-RU tetramers (all provided by the National Institutes of Health tetramer core facility) for 1 h before enrichment and further cell-surface staining (for I-A b GFP 81–95 ) or they were directly included into the surface antibody staining mix (for all other tetramers). Tetramer-binding CD4 + T cells were enriched by magnetic enrichment as described by Moon et al. 74 . Dead cells were detected using a Live/Dead Fixable Aqua Dead Cell Stain kit for 405-nm excitation (Thermo Fisher Scientific) or the fixable viability dye eFluor780 (eBioscience) according to manufacturers’ instructions and were excluded from further analysis unless stated otherwise.

For the detection of cleaved caspase-3, cells were fixed and permeabilized with BD Cytofix/Cytoperm (BD Bioscience) and stained with rabbit anti-mouse active caspase-3 (5A1E) on ice for 30 min, followed by incubation with PE-conjugated anti-rabbit IgG (H + L) F(ab′) 2 fragment antibody on ice for 30 min. Intracellular cytokine staining was performed using a BD Cytofix/Cytoperm kit (BD Bioscience) following manufacturer’s instructions.

Data were acquired on an LSR Fortessa, FACSCanto II (BD Biosciences) or Cytek Aurora (Cytek Biosciences) flow cytometer and analyzed with FlowJo software v.10 (BD Biosciences). Cell sorting was performed using FACS Aria III and FACS Fusion cell sorters (BD Biosciences).

Flow cytometry staining reagents

Monoclonal antibodies specific for CD4 (GK1.5, RM4-8), CD3e (145-2C11, 17A2), CD8α (53-6.7), CD8β (YT5156.7.7), PD-1 (REA802, 29F.1A12), CD24 (M1/69), CD44 (IM7), CD19 (1D3, 6D5), B220 (RA3-6B2), CD45.1 (A20), CD45.2 (104), F4/80 (BM8), CD11c (N418), NK1.1 (PK136), TCRβ (H57-597), TCRγδ (GL3), H2-K b (AF 6-885), H2-K d (SF1-1.1), cKit (2B8), Ter119 (Ter119), SiglecF (E50-2440), MHC class II (M5/114.15), Ly51 (REA988), EPCAM (REA977), TCRV α 2 (B20.1), TCRV β 4 (REA729), TNF (MAb11), Thy1.2 (30-H12), Thy1.1 (OX7), Ly49 (14B11), CD122 (TM-β1), CCR7 (4B12), CD25 (REA568), CD80 (16-10A1), CD86 (GL-1), IFNγ (REA638, XMG1.2), IL-4 (11B11) and IL-17A (TC11-18H10) were purchased from BioLegend, BD Biosciences, Miltenyi Biotec or Thermo Fisher Scientific. Monoclonal antibody targeting caspase-3 (5A1E) and anti-rabbit IgG (H + L) F(ab′) 2 fragments were purchased from Cell Signaling Technology. Streptavidin-APC (405207) was purchased from BioLegend. Biotinylated UEA1 was purchased from Vector Laboratories. All antibodies and staining reagents were used at dilutions specified by the manufacturer or determined experimentally.

Generation of BM chimeras

For all BM chimera experiments, BM cells from donor mice were stained with APC-labeled CD4, CD8, CD3, TCRβ, TCRγδ, NK1.1 and Ter119 antibodies, followed by magnetic depletion of T and NK cells with anti-APC microbeads (Miltenyi Biotec). BM cells (2 × 10 6 –5 × 10 6 ) were then transferred i.v. into lethally irradiated (split dose of 5 Gy, twice, using an Xstrahl CIX3 X-ray irradiator) recipients. For mixed BM chimera experiments shown in Fig. 3c , Jedi-TCRαβ BM cells were mixed with WT or IL-4–GFP BM cells at a 3:1 ratio before transfer. For mixed BM chimera experiments shown in Fig. 6b , Jedi-TCRβ H2 b/d BM cells were mixed at a 1:1 ratio with IL-4–GFP H2 b/b or IL-4–GFP H2 b/d BM cells before transfer. For mixed BM chimera experiments shown in Fig. 7 , Jedi-TCRβ BM cells were mixed at a 1:20 ratio with IL-17A–GFP or WT BM cells before transfer into WT recipients (all on a CB6F1 genetic background). For mixed BM chimera experiments shown in Supplementary Fig. 2 , Jedi-TCRβ or Jedi-TCRαβ BM cells were mixed at a 1:1 ratio with IL-4–GFP or WT BM cells before transfer into WT recipients (all on a BALB/c genetic background).

In vitro T H 2 cell and T H 17 cell differentiation

For T H 17 cell differentiation, CD4 + T cells from spleens of IL-17A–GFP mice on a CB6F1 genetic background were isolated by staining with APC-conjugated anti-CD4, followed by magnetic enrichment with anti-APC magnetic beads (Miltenyi Biotec). Enriched CD4 + T cells were cultured in six-well plates (precoated with 4 µg ml –1 anti-CD3e (Biolegend) in PBS at 4 °C overnight) in IMDM supplemented with 10% fetal calf serum (FCS), 50 µM 2-mercaptoethanol, 2 mM l -glutamine, 100 U ml –1 penicillin, 100 U ml –1 streptomycin, 0.5 µg ml –1 anti-CD28 (Biolegend), 50 ng ml –1 IL-6 (Peprotech), 2 ng ml –1 TGFβ (Peprotech), 2.5 µg ml –1 anti-IL-4 (Biolegend) and 2.5 µg ml –1 anti-IFNγ (Biolegend). The cells were used in in vivo killing assays 4 days after the start of the cultures.

For T H 2 cell differentiation, CD4 + T cells from spleens of WT C57BL/6J mice were isolated as described above. Enriched CD4 + T cells were cultured in six-well plates (precoated with 4 µg ml –1 anti-CD3e in PBS at 4 °C overnight) in IMDM supplemented with 10% FCS, 50 µM 2-mercaptoethanol, 2 mM l -glutamine, 100 U ml –1 penicillin, 100 U ml –1 streptomycin, 0.5 µg ml –1 anti-CD28, 10 ng ml –1 IL-2 (Peprotech), 20 ng ml –1 IL-4 (Peprotech) and 2.5 µg ml –1 anti-IFNγ. Induction of theT H 2 molecular program was confirmed by side-by-side analysis of GFP expression in T H 2 cells differentiated from IL-4–GFP CD4 + T cells (80–90% of GFP + cells). The cells were used for repetitive transfer into the indicated BM chimeras or in in vivo killing assays 4 days after the start of the cultures.

In vivo killing assays

In vitro-differentiated IL-17A–GFP T H 17 cells were labeled with 1 μM CTV (Thermo Fisher) in PBS with 0.5% bovine serum albumin (BSA) in a water bath at 37 °C for 8 min. Labeled cells were washed and i.v. transferred (0.5 × 10 6 ) into the indicated groups of BM chimeras. Disappearance of GFP hi CTV + cells was assessed by flow cytometry in the spleens of the recipient mice 20 h after transfer.

In vitro-differentiated T H 2 cells were labeled with 1 μM CTV and mixed with 10 μM CTV-labeled freshly isolated naive T cells at a 1:3 ratio. Labeled cells were washed with PBS and i.v. transferred into the indicated groups of BM chimeras (2 × 10 6 cells per mouse). The ratio between CTV int (T H 2) and CTV hi (naive) cells was assessed in the spleens of recipient mice 20 h after transfer by flow cytometry.

Construction of retroviral vectors

DNA fragments encoding full-length cytoplasmic OVA with N4 (SIINFEKL), Q4 (SIIQFEKL), T4 (SIITFEKL) and V4 (SIIVFEKL) versions of the OVA 257–264 epitope were synthesized by Twist Bioscience and cloned into a retroviral pMIG II vector 75 using BgIII and Xhol sites. To generate the Thy1.1-IRES-i.c.GFP construct, the Thy1.1-coding sequence was cloned into pMIG II using BglII and XhoI sites. To generate the Thy1.1-IRES-secGFP construct, the DNA sequence encoding a secretory signal peptide of the FSH-β subunit was inserted at the 5′ end of the GFP-coding sequence in the Thy1.1-IRES-i.c.GFP construct as described previously 76 with minor modifications. In brief, 5′- TGAAAAACACGATAATACCATGATGAAGTCGATCCAGCTTTGCATCCTACTCTGGTGCTTGAGAGCAGTCTGCTGCCATATGGTGAGCAAGGGCGAGG -3′ and 5′-CCTCGCCCTTGCTCACCATATGGCAGCAGACTGCTCTCAAGCACCAGAGTAGGATGCAAAGCTGGATCGACTTCATCATGGTATTATCGTGTTTTTCA -3′ oligonucleotides were annealed and mixed with linearized pMIG II vector (digested with NcoI) and incubated at 50 °C for 30 min with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). To generate the Thy1.1-only construct, the Thy1.1-IRES-i.c.GFP construct was digested with NotI and NcoI to remove the IRES-i.c.GFP cassette, followed by removal of overhangs using Klenow fragment (New England Biolabs) and self-ligation of the digested vector. To generate the Bcl-2-P2A-Thy1.1-IRES-secGFP construct, the Thy1.1-coding sequence in the Thy1.1-IRES-secGFP construct was replaced with a DNA fragment encoding Bcl-2-P2A-Thy1.1 (synthesized by Twist Bioscience) using BglII and XhoI sites.

Transfection and retrovirus production

HEK293T cells were cultured in DMEM supplemented with 10% FCS, 50 µM 2-mercaptoethanol, 2 mM l -glutamine, 100 U ml –1 penicillin and 100 U ml –1 streptomycin at 37 °C and 5% CO 2 until the confluency reached 70%. To test GFP expression and secretion, HEK293T cells were transiently transfected with Thy1.1-IRES-i.c.GFP or Thy1.1-IRES-secGFP constructs by calcium phosphate transfection, as previously described 77 . The culture medium was replaced with DMEM (without phenol red) 6 h after transfection. Supernatants were collected 8, 24 and 48 h after transfection, and fluorescence intensity was measured with a Varioskan LUX Multimode Microplate Reader (Thermo Fisher) at an excitation wavelength of 480 nm and emission wavelength of 520 nm (with a bandwidth of 12 nm).

Retrovirus-containing supernatants were generated by transient cotransfection of HEK293T cells with the retroviral constructs described above and pCL-Eco packaging vector using calcium phosphate transfection. Viral supernatants were collected 48 h after transfection, mixed thoroughly with 5× PEG solution (40% polyethylene glycol 10,000 (Sigma) and 2.4% NaCl dissolved in water) and incubated overnight at 4 °C. The next day, virus particles were precipitated by centrifugation at 2,000 g and 4 °C for 1 h, resuspended in fresh culture medium to reach 100-times the concentration and stored at −80 °C.

Immunization experiments

To study antigen-specific CD8 + T cell responses, mice were intraperitoneally injected with 200 µg of GFP 200–208 peptide (HYLSTQSAL, H2-K d epitope; Genscript) dissolved in PBS plus 50 µg of anti-CD40 (clone FGK4.5, BioXcell) and 50 µg of poly(I:C) (Invivogen).

For CD4 + T cell peptide immunizations, mice were subcutaneously injected with 100 µl of an emulsion containing 100 µg of GFP 81–95 peptide (HDFFKSAMPEGYVQE, I-A b epitope; Genscript). Emulsions were prepared by mixing the peptide in PBS in a 1:1 ratio with complete Freund’s adjuvant (Sigma-Aldrich).

For IFNγ and OVA peptide immunization, BM chimeric mice were intraperitoneally injected with 200 µg of IFNγ 69–78 peptide (QIISFYLRLF, H2-K b epitope; Genscript) and 50 µg of OVA 257–264 peptide (SIINFEKL, H2-K b epitope; Genscript) with 50 µg of anti-CD40 and 50 µg of poly(I:C).

Cytokine production assays

For characterization of thymic effector subsets in WT and PLZF lu/lu mice, isolated thymocytes were incubated in RPMI 1640 culture medium supplemented with 10% FCS, 50 µM 2-mercaptoethanol, 2 mM l -glutamine, 100 U ml –1 penicillin, 100 U ml –1 streptomycin, 50 ng ml –1 phorbol 12-myristate 13-acetate (PMA; Sigma), 1 μg ml –1 ionomycin (Sigma) and 3 μg ml –1 brefeldin A (Thermo Fisher) at 37 °C and 5% CO 2 . After 5 h, thymocytes were collected for surface antibody and viability staining, followed by intracellular staining using a BD Cytofix/Cytoperm kit (BD Biosciences) according to manufacturer’s instructions. For detection of intracellular cytokines in Tcrd –/– Cd1d –/– Mr1 –/– mice, isolated thymocytes were cultured in RPMI 1640 culture medium with 25 ng ml –1 PMA, 1 μg ml –1 ionomycin and 1 μg ml –1 brefeldin A for 4 h at 37 °C and 5% CO 2 .

For detection of antigen-specific CD8 + responses in peptide-immunized Ifng –/– /WT BM chimeras, spleens were collected 6 days after immunization and processed to a single-cell suspension. After erythrocyte lysis, splenocytes were resuspended in IMDM containing the indicated peptides (final concentration of 10 µg ml –1 ) and cultured in a six-well plate at a density of 2 × 10 6 cells per ml (1 × 10 7 cells per well) at 37 °C and 5% CO 2 . After a 1-h incubation, brefeldin A (3 μg ml –1 ) was added to the culture. Cells were collected, stained as described above and analyzed 5 h after the addition of brefeldin A. Antigen-specific CD8 + T cells were identified as TCRβ + CD8 + CD44 hi TNF + in Fig. 8 and Extended Data Fig. 8b,c .

Generation of the Jedi TCR-expressing reporter cell line

NFAT-sFT reporter-containing 16.2c11 cells 53 (a kind gift of J. Kisielow, Repertoire Immune Medicines) were retrovirally transduced with constructs encoding Jedi TCR, CD8α and CD8β. Retroviral transfection was performed as described previously 77 . Cells were sorted and expanded to generate a CD8α + CD8β + Jedi TCR-expressing reporter cell line.

In vitro cocultures with Jedi TCR-expressing reporter cells

Thymic iNKT cells (gated as GFP + CD1d tetramer-binding cells for IL-4–GFP and IL-17A–GFP mice and as CD1d tetramer-binding cells for WT mice), eosinophils (gated as SiglecF + SSC hi ) and DCs (gated as CD11c + MHC class II + ) from WT, IL-4–GFP and IL-17A–GFP mice were sorted and mixed with CD8α + CD8β + Jedi TCR-expressing 16.2c11 reporter cells in a 10:1 (iNKT cell:Jedi reporter cell and eosinophil:Jedi reporter cell) or 1:1 (DC:Jedi reporter cell) ratio in IMDM supplemented with 10% FCS, 50 µM 2-mercaptoethanol, 2 mM l -glutamine, 100 U ml –1 penicillin and 100 U ml –1 streptomycin. Cells were cultured in 96-well V-bottom plates at 37 °C and 5% CO 2 for approximately 20 h and analyzed by flow cytometry.

Retroviral infection of thymic iNKT cells

Single-cell suspensions of thymocytes were stained with APC-labeled antibodies to CD24 and CD8 (anti-CD11c was added for the experiment shown in Extended Data Fig. 6e ), followed by magnetic depletion with anti-APC microbeads (Miltenyi Biotec) to enrich for iNKT cells. Enriched thymic iNKT cells were cultured at a density of 1 × 10 6 cells per ml in IMDM supplemented with 10 ng ml –1 IL-7 (Peprotech), 100 ng ml –1 IL-15 (Peprotech), and 0.5 μg ml –1 CD1d-PBS-57 tetramer. After 2 days, iNKT cells were centrifuged at 400 g at room temperature for 5 min and resuspended in fresh IMDM containing 10 ng ml –1 IL-7, 100 ng ml –1 IL-15, 4 μg ml –1 polybrene (Sigma) and 20 μl ml –1 concentrated virus particles, transferred to plates precoated with 20 μg ml –1 RetroNectin (Takara) and spin infected at 1,000 g and 32 °C for 1 h. One more round of infection was performed 6 h after the first round of infection. Eighteen hours after the second round of infection, the culture medium was replaced with fresh IMDM containing 10 ng ml –1 IL-7 and 100 ng ml –1 IL-15. Forty-eight hours after the first round of infection, iNKT cells were used in RTOC and intrathymic transfer experiments.

Immunofluorescence microscopy of thymus sections

Organ sections were prepared as described previously 78 . For GFP detection, slides were incubated with Alexa Fluor 488-conjugated GFP booster (Chromotek), and staining was performed according to the manufacturer’s instructions. For mTEC detection, slides were incubated with biotinylated UEA1 (Vector Laboratories) followed by incubation with APC-conjugated streptavidin (BioLegend) according to the manufacturer’s instructions. Confocal images were acquired on an LSM 800 system (Carl Zeiss) at the Biomedicum Imaging Core at the Karolinska Institute. Images were processed using Zen 2.3 Black Edition (Carl Zeiss) or Imaris (Bitplane) imaging software.

RTOCs were performed as described previously 79 . Thymi from embryonic day 14.5–15.5 CB6F1 embryos were isolated, and single-cell suspensions were prepared by digesting in PBS containing 0.125% trypsin and 1.325 mM EDTA for 15–30 min at 37 °C. In total, 6 × 10 4 –9 × 10 4 (or 1.6 × 10 4 for live-cell imaging) Jedi DP thymocytes (gated as CD4 + CD8 + cells) sorted from the thymi of Jedi-TCRαβ mice (on a B10.D2 genetic background) and sorted iNKT cells (gated as CD1d tetramer-binding cells without additional gating on GFP) from the thymi of WT and IL-4–GFP or IL-17A–GFP mice or CD4SP thymocytes from WT and ACTB–GFP mice or thymic eosinophils (sorted as SiglecF + SSC hi cells) from WT and IL-4–GFP mice were mixed with 2 × 10 5 –3 × 10 5 cells from digested fetal CB6F1 thymi. RTOCs comparing i.c.GFP and secGFP were established as described above but with sorted Thy1.1 + thymic iNKT cells (on a CB6F1 background) transduced with the indicated constructs. RTOCs with OT-I cells were established as described above, but digested embryonic day 15.5 WT thymi were reaggregated with OT-I DP thymocytes (sorted as CD4 + CD8 + cells) and sorted GFP + cOVA-IRES-GFP-transduced thymic iNKT cells (all on a C57BL/6J background). Cell pellets were resuspended in less than 1.5 µl of RPMI 1640 (supplemented with 10% FCS, 50 µM 2-mercaptoethanol, 10 mM HEPES, 2 mM l -glutamine, 1× nonessential amino acids, 1 mM sodium pyruvate, 100 U ml –1 penicillin and 100 U ml –1 streptomycin) per RTOC. The cell suspension was transferred onto the membrane (Millipore Millicell 0.4-µm cell culture inserts) and placed in a six-well plate (Sarstedt) filled with the same medium as described above. For eosinophil-containing RTOCs, 5 ng ml –1 IL-33 (Peprotech) was added to the culture medium. For CD80/CD86 blocking experiments, 10 µg ml –1 anti-CD80 (16-10A1, BioLegend) and anti-CD86 (GL-1, BioLegend) or the corresponding isotype controls (HTK888, BioLegend; RTK2758, BioLegend) were added to the RTOC culture medium. Reaggregation and further culture were performed in humidified chambers placed in the cell culture incubator at 37 °C and 5% CO 2. Flow cytometric analysis was performed on day 5 of the culture. Live-cell imaging was performed 16–20 h after setup.

RTOC live-cell imaging

For live-cell imaging, RTOCs were prepared as described above with minor modifications. Jedi DP thymocytes (gated as CD4 + CD8 + PD-1 lo/int cells) isolated from the thymi of Jedi mice and iNKT cells (gated as GFP + CD1d tetramer-binding cells) from the thymi of IL-4–GFP mice were sorted. After sorting, Jedi DP thymocytes were loaded with 5 µM Cal-520 AM (AAT Bioquest) in HBSS containing 2% FCS for 1 h at 37 °C. DP Jedi cells were then washed twice with FCS-containing RPMI 1640 culture medium and labeled with 2.5 µM CTV (Thermo Fisher) in PBS/0.5% BSA for 8 min in a water bath at 37 °C, while thymic iNKT cells were labeled with 2.5 µM CTY (Thermo Fisher) under the same labeling conditions. RTOCs were allowed to assemble for 16–20 h before transfer to compartmentalized glass-bottom dishes (ibidi). For imaging, RTOCs were first embedded in PureCol EZ Gel solution (Sigma-Aldrich) for 45 min at 37 °C. RTOC complete medium was then added on top of the collagen matrix. z -stacks of two RTOCs were first imaged for each condition at a rate of 1 frame per min for 1–3 h using a ×20/0.8-NA Plan-Apochromat objective and a fast Airyscan detector on an LSM880 microscope (Carl Zeiss) with the incubation chamber set to 37 °C and 5% CO 2 . Afterward, longer acquisitions of 12 h at 1 frame per min were conducted using standard confocal settings.

RTOC live-cell imaging analysis

Maximum intensity projections of confocal datasets were generated and analyzed in Zen Lite software (Carl Zeiss). Cell contacts were defined by colocalization of an iNKT cell and a Jedi thymocyte for at least three frames (one frame = 1 min). Contact identified using maximum intensity projections was then validated using the full three-dimensional datasets. Consecutive detachment and attachment between two cells with short intervals (shorter than five frames) were counted as one contact. In total, 134 contacts (for RTOCs with WT iNKT cells) and 108 contacts (for RTOCs with IL-4–GFP iNKT cells) were analyzed manually for an increase in Cal-520 AM fluorescence to enumerate Ca 2+ signaling events (Fig. 6e ). For quantification of contact length, the number of frames where cell colocalization had been observed was counted. Contacts where cells could not be tracked throughout the entire contact (for example, cells masked by other cells and cells disappearing from the field of view) were excluded from this analysis. Contacts lasting for 2 frames or less were also excluded from quantification of contact length.

For quantification of Cal-520 AM signal intensity over time, ten contacts from each group (WT iNKT cells, IL-4–GFP iNKT cells with Ca 2+ signaling detected and IL-4–GFP iNKT cells with no Ca 2+ signaling detected) were randomly selected and analyzed in ImageJ. The Cal-520 AM signal intensity and CTV signal intensity in Jedi cells were quantified by measuring the mean intensity of each signal in the region of interest (ROI; corresponding to a Jedi cell) drawn manually for each frame. For each frame, Ca 2+ signal intensity of the Jedi cell was calculated as Ca 2+ signal intensity (per frame) = (mean intensity of Cal­-520 AM in ROI)/(mean intensity of CTV in ROI). The baseline Ca 2+ signal intensity for each Jedi cell was then calculated by averaging the Ca 2+ signal intensity (per frame) for five frames right before contact initiation. Normalized Ca 2+ signal intensities plotted in Fig. 6f and Extended Data Fig. 6g were calculated for each frame using the following equation: normalized Ca 2+ signal intensity = (Ca 2+ signal intensity (per frame))/(baseline Ca 2+ signal intensity).

Intrathymic injections

Intrathymic injections were performed as previously described 24 . Four- to 5-week-old Jedi-TCRβ recipient mice were anesthetized by intraperitoneal injection of a ketamine (80 mg per kg (body weight))/xylazine (8 mg per kg (body weight)) solution. Subcutaneous injection of carprofen (5 mg kg – 1 (body weight)) was performed 30–60 min before surgery. When fully anesthetized, the fur was shaved, and a small incision in the skin above the sternum was made. For experiments shown in Fig. 5d , up to 1 × 10 6 iNKT cells (gated as CD1d tetramer-binding cells without additional gating on GFP) sorted from the thymi of IL-4–GFP mice were resuspended in 10 µl of PBS, and 5 µl per thymus lobe was injected. For experiments shown in Extended Data Fig. 6e , total cells from Bcl-2-P2A-Thy1.1-IRES-secGFP transduction cultures containing 6 × 10 5 transduced (Thy1.1 + ) iNKT cells were resuspended in 10 µl of PBS, and 5 µl per thymus lobe was injected. Bcl-2 was added to the construct to improve survival of intrathymically transferred iNKT cells. The skin incision was closed with sutures, and mice were intraperitoneally injected with atipamezole (4 mg per kg (body weight)). Carprofen (5 mg per kg (body weight)) was subcutaneously injected once a day until 72 h after surgery. Flow cytometric analysis was performed 7 days after injection.

Autoantibody profiling using bead-based protein microarrays

Serum from PLZF lu/lu mice was tested for the presence of antibodies against autoantigens and proteins from pathogens. A custom microbead-based antigen array was created to profile serum samples for antibodies against cytokines, autoimmune-associated antigens and viral antigens, as previously described 80 . The array was constructed by conjugating antigens to uniquely barcoded carboxylated magnetic beads (MagPlex-C, Luminex). Beads were qualified using prototype plasma or serum samples with known reactivities. Although the available array was constructed using human antigens, protein homology with mouse antigens still allowed for comparisons in mouse autoantibody development 81 , 82 . Mouse serum samples were tested at a dilution of 1:100 in 0.05% PBS-Tween supplemented with 1% (wt/vol) BSA. Bound antibody was detected using R-PE-conjugated Fcγ-specific goat anti-mouse IgG F(ab′) 2 fragment (Jackson ImmunoResearch, 115-116-071) before analysis using a FlexMap3D instrument (Luminex). Binding events were displayed as median fluorescence intensity (MFI). For normalization, the MFI value for the ‘bare bead’ ID (no conjugated antigen) was subtracted from the MFI value for the antigen-conjugated bead ID. Samples were run in duplicate. Serum samples from MR/ Fas lpr/lpr mice (a mouse model for systemic lupus erythematosus) served as positive controls.

Analysis of public expression datasets

AnnData objects containing previously described human and mouse thymus cell atlases 35 were downloaded from https://developmental.cellatlas.io/thymus-development and were replotted using Scanpy 83 (version 1.9.1). The combined human effector T cell signature used in Extended Data Fig. 1 was generated using the sc.tl.score_genes Scanpy function and the following list of effector program genes: IL13 , IL-17A , IL17F , IFNG , GZMB and GZMK . Analysis of the Immgen dataset was described previously 33 .

Statistical analysis

Statistical analyses were performed with GraphPad Prism 9 software. Error bars represent standard deviation of biological replicates (or individual RTOCs) unless stated otherwise. Two-tailed unpaired Student’s t -tests or two-tailed Mann–Whitney tests were used to assess the statistical significance of one observed parameter between two experimental groups. An unpaired ANOVA with a Holm–Sidak multiple comparisons test or a Kruskal–Wallis test was used when more than two experimental groups were compared.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Source data are provided with this paper.

Kyewski, B. & Derbinski, J. Self-representation in the thymus: an extended view. Nat. Rev. Immunol. 4 , 688–698 (2004).

Article   CAS   PubMed   Google Scholar  

Anderson, M. S. et al. Projection of an immunological self shadow within the thymus by the AIRE protein. Science 298 , 1395–1401 (2002).

Takaba, H. et al. Fezf2 orchestrates a thymic program of self-antigen expression for immune tolerance. Cell 163 , 975–987 (2015).

Michelson, D. A., Hase, K., Kaisho, T., Benoist, C. & Mathis, D. Thymic epithelial cells co-opt lineage-defining transcription factors to eliminate autoreactive T cells. Cell 185 , 2542–2558 (2022).

Article   CAS   PubMed   PubMed Central   Google Scholar  

Miller, C. N. et al. Thymic tuft cells promote an IL-4-enriched medulla and shape thymocyte development. Nature 559 , 627–631 (2018).

Bornstein, C. et al. Single-cell mapping of the thymic stroma identifies IL-25-producing tuft epithelial cells. Nature 559 , 622–626 (2018).

Givony, T. et al. Thymic mimetic cells function beyond self-tolerance. Nature 622 , 164–172 (2023).

Březina, J., Vobořil, M. & Filipp, D. Mechanisms of direct and indirect presentation of self-antigens in the thymus. Front. Immunol. 13 , 926625 (2022).

Article   PubMed   PubMed Central   Google Scholar  

Guerder, S., Viret, C., Luche, H., Ardouin, L. & Malissen, B. Differential processing of self-antigens by subsets of thymic stromal cells. Curr. Opin. Immunol. 24 , 99–104 (2012).

Klein, L., Kyewski, B., Allen, P. M. & Hogquist, K. A. Positive and negative selection of the T cell repertoire: what thymocytes see (and don’t see). Nat. Rev. Immunol. 14 , 377–391 (2014).

Perera, J. et al. Self-antigen-driven thymic B cell class switching promotes T cell central tolerance. Cell Rep. 17 , 387–398 (2016).

Yamano, T. et al. Thymic B cells are licensed to present self antigens for central T cell tolerance induction. Immunity 42 , 1048–1061 (2015).

Perera, J., Meng, L., Meng, F. & Huang, H. Autoreactive thymic B cells are efficient antigen-presenting cells of cognate self-antigens for T cell negative selection. Proc. Natl Acad. Sci. USA 110 , 17011–17016 (2013).

von Boehmer, H. in Advances in Immunology , Vol. 84 (ed. Alt, F. W.) 201–238 (Academic Press, 2004).

Badr, M. E., Zhang, Z., Tai, X. & Singer, A. CD8 T cell tolerance results from eviction of immature autoreactive cells from the thymus. Science 382 , 534–541 (2023).

Baldwin, T. A., Hogquist, K. A. & Jameson, S. C. The fourth way? Harnessing aggressive tendencies in the thymus. J. Immunol. 173 , 6515–6520 (2004).

Lee, M. et al. Single-cell RNA sequencing identifies shared differentiation paths of mouse thymic innate T cells. Nat. Commun. 11 , 4367 (2020).

Lee, Y. J., Holzapfel, K. L., Zhu, J., Jameson, S. C. & Hogquist, K. A. Steady-state production of IL-4 modulates immunity in mouse strains and is determined by lineage diversity of iNKT cells. Nat. Immunol. 14 , 1146–1154 (2013).

Stetson, D. B. et al. Constitutive cytokine mRNAs mark natural killer (NK) and NK T cells poised for rapid effector function. J. Exp. Med. 198 , 1069–1076 (2003).

Cohen, N. R. et al. Shared and distinct transcriptional programs underlie the hybrid nature of iNKT cells. Nat. Immunol. 14 , 90–99 (2013).

Legoux, F., Salou, M. & Lantz, O. Unconventional or preset αβ T cells: evolutionarily conserved tissue-resident T cells recognizing nonpeptidic ligands. Annu. Rev. Cell Dev. Biol. 33 , 511–535 (2017).

Ribot, J. C., Lopes, N. & Silva-Santos, B. γδ T cells in tissue physiology and surveillance. Nat. Rev. Immunol. 21 , 221–232 (2021).

Tan, L. et al. Single-cell transcriptomics identifies the adaptation of Scart1 + Vγ6 + T cells to skin residency as activated effector cells. Cell Rep. 27 , 3657–3671 (2019).

Wang, H. & Hogquist, K. A. CCR7 defines a precursor for murine iNKT cells in thymus and periphery. eLife 7 , e34793 (2018).

Verykokakis, M., Boos, M. D., Bendelac, A. & Kee, B. L. SAP protein-dependent natural killer T-like cells regulate the development of CD8 + T cells with innate lymphocyte characteristics. Immunity 33 , 203–215 (2010).

Weinreich, M. A., Odumade, O. A., Jameson, S. C. & Hogquist, K. A. T cells expressing the transcription factor PLZF regulate the development of memory-like CD8 + T cells. Nat. Immunol. 11 , 709–716 (2010).

Cosway, E. J. et al. Eosinophils are an essential element of a type 2 immune axis that controls thymus regeneration. Sci. Immunol. 7 , eabn3286 (2022).

White, A. J. et al. A type 2 cytokine axis for thymus emigration. J. Exp. Med. 214 , 2205–2216 (2017).

Breed, E. R. et al. Type 2 cytokines in the thymus activate Sirpα + dendritic cells to promote clonal deletion. Nat. Immunol. 23 , 1042–1051 (2022).

Otero, D. C., Baker, D. P. & David, M. IRF7-dependent IFN-β production in response to RANKL promotes medullary thymic epithelial cell development. J. Immunol. 190 , 3289–3298 (2013).

Vobořil, M. et al. Toll-like receptor signaling in thymic epithelium controls monocyte-derived dendritic cell recruitment and T reg generation. Nat. Commun. 11 , 2361 (2020).

ElTanbouly, M. A. & Noelle, R. J. Rethinking peripheral T cell tolerance: checkpoints across a T cell’s journey. Nat. Rev. Immunol. 21 , 257–267 (2021).

Mingueneau, M. et al. The transcriptional landscape of αβT cell differentiation. Nat. Immunol. 14 , 619–632 (2013).

Heng, T. S. & Painter, M. W. The Immunological Genome Project: networks of gene expression in immune cells. Nat. Immunol. 9 , 1091–1094 (2008).

Park, J.-E. et al. A cell atlas of human thymic development defines T cell repertoire formation. Science 367 , eaay3224 (2020).

Kernfeld, E. M. et al. A single-cell transcriptomic atlas of thymus organogenesis resolves cell types and developmental maturation. Immunity 48 , 1258–1270 (2018).

Savage, A. K. et al. The transcription factor PLZF directs the effector program of the NKT cell lineage. Immunity 29 , 391–403 (2008).

Kovalovsky, D. et al. The BTB-zinc finger transcriptional regulator PLZF controls the development of invariant natural killer T cell effector functions. Nat. Immunol. 9 , 1055–1064 (2008).

Alonzo, E. S. et al. Development of promyelocytic zinc finger and ThPOK-expressing innate γδ T cells is controlled by strength of TCR signaling and Id3. J. Immunol. 184 , 1268–1279 (2010).

Kreslavsky, T. et al. TCR-inducible PLZF transcription factor required for innate phenotype of a subset of γδ T cells with restricted TCR diversity. Proc. Natl Acad. Sci. USA 106 , 12453–12458 (2009).

Mohrs, M., Shinkai, K., Mohrs, K. & Locksley, R. M. Analysis of type 2 immunity in vivo with a bicistronic IL-4 reporter. Immunity 15 , 303–311 (2001).

Gambotto, A. et al. Immunogenicity of enhanced green fluorescent protein (EGFP) in BALB/c mice: identification of an H2-K d -restricted CTL epitope. Gene Ther. 7 , 2036–2040 (2000).

Malhotra, D. et al. Tolerance is established in polyclonal CD4 + T cells by distinct mechanisms, according to self-peptide expression patterns. Nat. Immunol. 17 , 187–195 (2016).

Agudo, J. et al. GFP-specific CD8 T cells enable targeted cell depletion and visualization of T-cell interactions. Nat. Biotechnol. 33 , 1287–1292 (2015).

Watanabe, M., Lu, Y., Breen, M. & Hodes, R. J. B7-CD28 co-stimulation modulates central tolerance via thymic clonal deletion and T reg generation through distinct mechanisms. Nat. Commun. 11 , 6264 (2020).

Pobezinsky, L. A. et al. Clonal deletion and the fate of autoreactive thymocytes that survive negative selection. Nat. Immunol. 13 , 569–578 (2012).

Punt, J. A., Osborne, B. A., Takahama, Y., Sharrow, S. O. & Singer, A. Negative selection of CD4 + CD8 + thymocytes by T cell receptor-induced apoptosis requires a costimulatory signal that can be provided by CD28. J. Exp. Med. 179 , 709–713 (1994).

Buhlmann, J. E., Elkin, S. K. & Sharpe, A. H. A role for the B7-1/B7-2:CD28/CTLA-4 pathway during negative selection. J. Immunol. 170 , 5421–5428 (2003).

Breed, E. R., Watanabe, M. & Hogquist, K. A. Measuring thymic clonal deletion at the population level. J. Immunol. 202 , 3226–3233 (2019).

Hwang, I. et al. T cells can use either T cell receptor or CD28 receptors to absorb and internalize cell surface molecules derived from antigen-presenting cells. J. Exp. Med. 191 , 1137–1148 (2000).

Sabzevari, H. et al. Acquisition of CD80 (B7-1) by T cells. J. Immunol. 166 , 2505–2513 (2001).

Zehn, D., Lee, S. Y. & Bevan, M. J. Complete but curtailed T-cell response to very low-affinity antigen. Nature 458 , 211–214 (2009).

Kisielow, J., Obermair, F.-J. & Kopf, M. Deciphering CD4 + T cell specificity using novel MHC–TCR chimeric receptors. Nat. Immunol. 20 , 652–662 (2019).

Cappellano, G. et al. Anti-cytokine autoantibodies in autoimmune diseases. Am. J. Clin. Exp. Immunol. 1 , 136–146 (2012).

PubMed   PubMed Central   Google Scholar  

Seong Hoe, P. et al. HLA-DR expression in human fetal thymocytes. Hum. Immunol. 33 , 294–298 (1992).

Article   Google Scholar  

Pircher, H., Müller, K.-P., Kyewski, B. A. & Hengartner, H. Thymocytes can tolerize thymocytes by clonal deletion in vitro. Int. Immunol. 4 , 1065–1069 (1992).

Melichar, H. J., Ross, J. O., Taylor, K. T. & Robey, E. A. Stable interactions and sustained TCR signaling characterize thymocyte–thymocyte interactions that support negative selection. J. Immunol. 194 , 1057–1061 (2015).

Tian, C., Bagley, J., Forman, D. & Iacomini, J. Induction of central tolerance by mature T cells. J. Immunol. 173 , 7217–7222 (2004).

Webb, S. R. & Sprent, J. Induction of neonatal tolerance to Mlsa antigens by CD8 + T cells. Science 248 , 1643–1646 (1990).

Nitta, T. et al. Fibroblasts as a source of self-antigens for central immune tolerance. Nat. Immunol. 21 , 1172–1180 (2020).

Article   PubMed   Google Scholar  

Throsby, M., Herbelin, A., Pléau, J.-M. & Dardenne, M. CD11c + eosinophils in the murine thymus: developmental regulation and recruitment upon MHC class I-restricted thymocyte deletion. J. Immunol. 165 , 1965–1975 (2000).

Gabrielli, S. et al. Murine thymic NK cells are distinct from ILC1s and have unique transcription factor requirements. Eur. J. Immunol. 47 , 800–805 (2017).

Jones, R. et al. Dynamic changes in intrathymic ILC populations during murine neonatal development. Eur. J. Immunol. 48 , 1481–1491 (2018).

Wang, H. et al. Myeloid cells activate iNKT cells to produce IL-4 in the thymic medulla. Proc. Natl Acad. Sci. USA 116 , 22262–22268 (2019).

Etzensperger, R. et al. Identification of lineage-specifying cytokines that signal all CD8 + -cytotoxic-lineage-fate ‘decisions’ in the thymus. Nat. Immunol. 18 , 1218–1227 (2017).

Xing, Y., Wang, X., Jameson, S. C. & Hogquist, K. A. Late stages of T cell maturation in the thymus involve NF-κB and tonic type I interferon signaling. Nat. Immunol. 17 , 565–573 (2016).

Dalton, D. K. et al. Multiple defects of immune cell function in mice with disrupted interferon-γ genes. Science 259 , 1739–1742 (1993).

Buaas, F. W. et al. PLZF is required in adult male germ cells for stem cell self-renewal. Nat. Genet. 36 , 647–652 (2004).

Hogquist, K. A. et al. T cell receptor antagonist peptides induce positive selection. Cell 76 , 17–27 (1994).

Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T. & Nishimune, Y. ‘Green mice’ as a source of ubiquitous green cells. FEBS Lett. 407 , 313–319 (1997).

Ataide, M. A. et al. Lymphatic migration of unconventional T cells promotes site-specific immunity in distinct lymph nodes. Immunity 55 , 1813–1828 (2022).

Sheridan, B. S. & Lefrançois, L. Isolation of mouse lymphocytes from small intestine tissues. Curr. Protoc. Immunol. 3 , 3.19.11 (2012).

Google Scholar  

Xing, Y. & Hogquist, K. A. Isolation, identification, and purification of murine thymic epithelial cells. J. Vis. Exp. 8 , e51780 (2014).

Moon, J. J. et al. Tracking epitope-specific T cells. Nat. Protoc. 4 , 565–581 (2009).

Holst, J. et al. Generation of T-cell receptor retrogenic mice. Nat. Protoc. 1 , 406–417 (2006).

Roh, J. Y. et al. Modification of enhanced green fluorescent protein for secretion out of cells. Biotechnol. Bioprocess Eng. 18 , 1135–1141 (2013).

Article   CAS   Google Scholar  

Dunst, J. et al. Recognition of synthetic polyanionic ligands underlies ‘spontaneous’ reactivity of Vγ1 γδTCRs. J. Leukoc. Biol. 107 , 1033–1044 (2020).

Rauschmeier, R. et al. Bhlhe40 function in activated B and T FH cells restrains the GC reaction and prevents lymphomagenesis. J. Exp. Med. 219 , e20211406 (2022).

Anderson, G. & Jenkinson, E. J. Fetal thymus organ culture. CSH Protoc. 2007 , pdb.prot4808 (2007).

Chang, S. E. et al. New-onset IgG autoantibodies in hospitalized patients with COVID-19. Nat. Commun. 12 , 5417 (2021).

Degn, S. E. et al. Clonal evolution of autoreactive germinal centers. Cell 170 , 913–926 (2017).

de Carvalho, R. V. H. et al. Clonal replacement sustains long-lived germinal centers primed by respiratory viruses. Cell 186 , 131–146 (2023).

Wolf, F. A., Angerer, P. & Theis, F. J. SCANPY: large-scale single-cell gene expression data analysis. Genome Biol. 19 , 15 (2018).

Download references

Acknowledgements

We thank M. Aichinger and G. Wirnsberger for a discussion that facilitated the initiation of this project. We thank the National Institutes of Health tetramer core facility for the preparation of all tetramers used in this study. This study was supported by the Swedish Research Council (grants 2017-01118 and 2021-01468 to T.K.), Cancerfonden (grants CAN 2018/710 and 21 1602 Pj to T.K.), Barncancerfonden (grants PR2021-017 and PR2023-0091 to T.K.), Radiumhemmets Forskningsfonder (grants 211192 and 231233 to T.K.), a stipend from the German Research Foundation (DU 1964/1-1 to J.D.) and a stipend from the China Scholarship Council (to Y.Y.). 16.2c11 reporter cells were provided by J. Kisielow (Repertoire Immune Medicines). We thank S. Edwards and the Advanced Light Microscopy facility at Science for Life Laboratory for their help setting up the imaging of the RTOCs. We thank J. Coquet, S. Nylén and A. Gigliotti Rothfuchs (Karolinska Insitutet) and members of their laboratories for their help with experiments that were not included in the manuscript. We thank all members of the Kreslavsky laboratory for their support, discussions of the project and critical reading of the manuscript.

Open access funding provided by Karolinska Institute.

Author information

These authors contributed equally: Yuanyuan You, Josefine Dunst.

Authors and Affiliations

Division of Immunology and Allergy, Department of Medicine Solna, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden

Yuanyuan You, Josefine Dunst, Kewei Ye, Annika Reinhardt & Taras Kreslavsky

Center for Molecular Medicine, Karolinska Institutet, Stockholm, Sweden

Yuanyuan You, Josefine Dunst, Kewei Ye, Annika Reinhardt, Natalia R. Comet, Carmen Gerlach & Taras Kreslavsky

Department of Applied Physics, Science for Life Laboratory, KTH Royal Institute of Technology, Stockholm, Sweden

Patrick A. Sandoz & Björn Önfelt

Institute of Immunology, Hannover Medical School, Hannover, Germany

Inga Sandrock & Immo Prinz

Division of Rheumatology, Department of Medicine Solna, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden

Natalia R. Comet & Carmen Gerlach

Max Planck Research Group, Würzburg Institute of Systems Immunology, Julius-Maximilians-Universität Würzburg, Würzburg, Germany

Rupak Dey Sarkar & Wolfgang Kastenmüller

Department of Medicine, Division of Immunology and Rheumatology, Stanford University, Stanford, CA, USA

Emily Yang & Paul J. Utz

Epigenetic Factors in Normal and Malignant Hematopoiesis Lab, CRCM, CNRS, INSERM, Institut Paoli Calmettes, Aix Marseille University, Marseille, France

Estelle Duprez

Equipe Labellisée Ligue Nationale Contre le Cancer, Paris, France

Department of Cancer Immunology and Virology, Dana-Farber Cancer Institute, Boston, MA, USA

Judith Agudo

Parker Institute for Cancer Immunotherapy, Dana-Farber Cancer Institute, Boston, MA, USA

Department of Immunology, Harvard Medical School, Boston, MA, USA

Ludwig Center at Harvard, Boston, MA, USA

The Precision Immunology Institute, Icahn School of Medicine at Mount Sinai, New York, NY, USA

Brian D. Brown

Icahn Genomics Institute, Icahn School of Medicine at Mount Sinai, New York, NY, USA

Department of Immunology and Immunotherapy, Icahn School of Medicine at Mount Sinai, New York, NY, USA

Institute for Immunity, Transplantation and Infection, Stanford University School of Medicine, Stanford, CA, USA

Paul J. Utz

Hamburg Center for Translational Immunology (HCTI), University Medical Center Hamburg-Eppendorf, Hamburg, Germany

Institute of Systems Immunology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany

Center for Infectious Medicine, Department of Medicine Huddinge, Karolinska Institutet, Stockholm, Sweden

Björn Önfelt

You can also search for this author in PubMed   Google Scholar

Contributions

Y.Y. performed most of the experiments. J.D. designed and supervised some of the experiments and performed most of the intrathymic transfer experiments and the initial RTOC experiments. K.Y. contributed to the RTOC and peptide immunization experiments. P.A.S. and B.Ö. performed RTOC imaging. N.R.C. and C.G. provided expertise and training for the intrathymic transfer experiments. I.S. and I.P. performed the initial experiments with IL-17A–GFP mice. E.D. provided PLZF lu/lu mice and collected sera from these animals. J.A. and B.D.B. generated and provided Jedi mice. R.D.S. and W.K. performed analyses of Tcrd –/– Cd1d –/– Mr1 –/– mice. E.Y. and P.J.U. performed antigen array experiments. A.R. and K.Y. analyzed the data and prepared the figures. T.K. suggested the project idea, supervised the study and wrote the manuscript. Y.Y., J.D., K.Y., A.R., C.G. and T.K. edited the manuscript.

Corresponding author

Correspondence to Taras Kreslavsky .

Ethics declarations

Competing interests.

The authors declare no competing financial interests.

Peer review

Peer review information.

Nature Immunology thanks Ludger Klein and Jung Hyun Park for their contribution to the peer review of this manuscript. Primary Handling Editor: S. Houston, in collaboration with the Nature Immunology team. Peer reviewer reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended data fig. 1 human thymic innate and innate-like lymphocytes express a broad spectrum of inflammation-associated self-antigens..

UMAP highlighting the expression of combined effector T cell gene signature (generated as describe in Methods ) (top) and UMAPs highlighting the expression of the indicated genes in the human thymus cell atlas scRNA-seq dataset.

Extended Data Fig. 2 Characterization of GFP-expressing cell types in IL-4-GFP thymi.

a . Gating strategy for characterization of GFP-expressing cell types in IL4-GFP thymi. b . Frequency of GFP + cells in the indicated thymic subsets in IL4-GFP mice (n = 3 mice). c . Frequency of GFP + cells among mTECs (gated as EPCAM + CD45 – UEA1 + Ly51 – ) in IL4-GFP mice (n = 3 mice). d . Images of IL4-GFP and WT thymi sections as analyzed by confocal immunofluorescence microscopy as in Fig. 3b . An area of the same image as in Fig. 3b is shown for the IL4-GFP mouse. e . Frequency of GFP + hematopoietic cells in the thymi of mixed BM chimeras shown in Fig. 3c, e . Quantification (left) and representative flow cytometric plots (right) are shown (n = 4 chimeras for [WT+Jedi-TCRαβ]→WT thymi, n = 6 for the other groups). Data are presented as the mean ± s.d.

Extended Data Fig. 3 Antigen expression exclusively by small numbers of conventional thymocytes or thymic eosinophils is sufficient to induce elimination of autoreactive thymocytes.

a . Schematic representation of RTOC experiments shown in b-c. b - c RTOCs with Jedi-TCRαβ DP thymocytes established and analyzed as in Fig. 4a, b but with WT or Actb-GFP CD4SP thymocytes (b) and WT or IL4-GFP eosinophils (c) used as antigen source. Representative plots showing frequencies of GFP-expressing cells, frequencies of H2-K d GFP 200-208 tetramer-binding Jedi thymocytes (quantification shown on the right) and expression of the indicated cell surface markers by the latter cells. Representative results of three independent experiments (b) (n = 2 RTOCs for WT CD4SP, n = 5 for Actb-GFP CD4SP) or results of one experiment (c) (n = 2 for WT eosinophils, n = 3 for IL4-GFP eosinophils). Data are presented as the mean ± s.d.

Extended Data Fig. 4 Assessment of possible effects of co-stimulation on induction of tolerance by innate-like T cells.

a . Expression of CD80 (top) and CD86 (bottom) by the indicated thymic populations (red) in an IL4-GFP mouse. Isotype control for CD80 is shown in grey (same in both rows). Percentage of positive cells and median fluorescent intensity (MFI) in the positive gate are indicated. The following thymic populations were analyzed: B cells (CD19 + MHC-II + ), DCs (CD11c + MHC-II + ), eosinophils (IL4-GFP + SSC hi ), γδT cells (CD3 + TCRγδ + ), iNKT (TCRβ + CD1d-PBS-57 tetramer + ), CD4SP (CD4 + ), CD8SP (CD8 + ), and DP cells (CD4 + CD8 + ). b . RTOCs were established and analyzed as in Fig. 4b , but blocking antibodies against CD80 and CD86 or isotype control antibodies were added to culture medium. Representative results of two independent experiments (n = 5 RTOCs for WT isotype group, n = 6 for the other groups). Data are presented as the mean ± s.d. with NS: non-significant ( P > 0.05), ** P < 0.01, *** P < 0.001, and **** P < 0.0001. Data were analyzed by two-way ANOVA with Holm-Sidak’s multiple comparisons test. c . HEK293T cells were transfected with Thy1.1-IRES-i.c.GFP or Thy1.1-IRES-secGFP retroviral constructs. Expression of Thy1.1 and GFP by HEK293T cells 48 hours after transfection (left, contour plot overlay as well as histogram overlays for Thy1.1 and GFP are shown) and the mean value of GFP fluorescence in culture supernatants of the same cells at different timepoints (right) are shown. Error bars represent s.d. of technical replicates (n = 2 for untransfected group, n = 3 for the other groups).

Extended Data Fig. 5 Characterization of GFP-expressing cell types in IL17A-GFP thymi.

a . Gating strategy for characterization of GFP-expressing cell types in IL17A-GFP thymi. b . Frequency of GFP + cells in the indicated thymic subsets in IL17A-GFP mice (n = 5 mice). c . Frequency of GFP + cells among mTECs (gated as EPCAM + CD45 – UEA1 + Ly51 – ) from IL17A-GFP mice (n = 3 mice). d . WT and IL17A-GFP mice (on C57BL/6J background) were immunized s.c. with GFP 81-95 peptide in CFA or left unimmunized (WT only). 14 days after immunization, I-A b GFP 81-95 tetramer-binding cells were magnetically enriched from pooled lymph nodes and spleens and quantified by flow cytometry. Representative flow cytometry plots gated on CD4 T cells (left) and absolute numbers of CD4 + CD44 + Tetramer + T cells (right) are shown. Representative results of two independent experiments (n = 4 mice per group). e . Comparison of the frequencies of GFP + hematopoietic cells in the thymi of IL17A-GFP mice and in IL17A-GFP→WT BM chimeras (analyzed ≥ 7 weeks after reconstitution) (n = 4 for IL17A-GFP mice, n = 6 for chimeras). Data are presented as the mean ± s.d. with NS: non-significant ( P > 0.05). Data were analyzed by two-tailed Student’s t test (d).

Extended Data Fig. 6 Direct presentation by model antigen-expressing populations rather than cross-presentation by professional APCs is responsible for elimination of autoreactive GFP-specific CD8 thymocytes.

a . iNKT cells, eosinophils and DCs were sorted from thymi of WT, IL4-GFP and IL17A-GFP mice and co-cultured overnight with slow fluorescent timer (sFT) NFAT reporter-containing 16.2c11 cells that were engineered to express the Jedi TCR, CD8α and CD8β. Activation of NFAT signaling was measured by sFT-Blue reporter upregulation. b . RTOCs with sorted Jedi DP thymocytes and iNKT cells were established and analyzed as in Fig. 6a , but using iNKT cells sorted from WT mice (on H2 b/d background) or from IL17A-GFP mice on H2 b/d and H2 b/b backgrounds. Results of one experiment (n = 3 RTOCs for IL17A-GFP H-2 b/b group, n = 4 for the other groups). c . Thymic iNKT cells from H2 d/d (BALB/c background) or H2 b/b (C57BL/6J background) mice were transduced with Thy1.1-IRES-i.c.GFP, Thy1.1-IRES-secGFP and Thy1.1-only retroviruses. Sorted Thy1.1 + iNKT cells were added to RTOCs together with Jedi-TCRαβ DP thymocytes. Flow cytometric analysis and quantification are shown. Results of one experiment (n = 6 RTOCs for H-2 d/d i.c.GFP and H-2 d/d secGFP groups, n = 7 for the other groups). d . Mixed BM chimeras were established as described in Fig. 7b . Expression of H-2K b and H2-K d on thymic DCs (gated as CD11c + MHC II + ) was analyzed by flow cytometry. e . Thymic iNKT cells from H2 b/d (CB6F1 background) or H2 b/b (C57BL/6J background) mice were transduced with Bcl2-P2A-Thy1.1-IRES-secGFP-encoding retroviruses and injected into the thymi of Jedi-TCRβ mice (on CB6F1 background). Expression of CD8α, CD8β and PD1 on CD4 – H2-K d GFP 200-208 tetramer-binding thymocytes is shown 7 days after transfer. f . Gating strategy showing utilization of low levels of PD1 as a surrogate marker for TCR expression on DP thymocytes from Jedi-TCRαβ mice. g . Normalized Ca 2+ signaling intensity in Jedi thymocytes interacting with iNKT cells as in Fig. 6f , but values for individual cells are shown. Data are presented as the mean ± s.d. with NS: non-significant ( P > 0.05) and ** P < 0.01. Data were analyzed by one-way ANOVA with Holm-Sidak’s multiple comparisons test.

Extended Data Fig. 7 Decreased thymic abundance of IL17A-GFP results in autoimmune elimination of GFP + T H 17 cells.

a . Comparison of the frequencies of GFP + lymphocytes in the thymi, spleens and mLNs of IL17A-GFP mice and in IL17A-GFP→WT BM chimeras (analyzed 8 weeks after reconstitution). One experiment with 2 IL17A-GFP mice and 3 BM chimeras. b–e . WT recipient mice were irradiated and transferred i.v. with T- and NK-cell depleted BM cells from either IL17A-GFP mice, or Jedi-TCRβ mice and WT mice, or Jedi-TCRβ mice and IL17A-GFP mice (all on CB6F1 background). Mesenteric lymph nodes (mLN) (b, d) and thymi (c, e) were analyzed 8 weeks after reconstitution. Same experiment as in Fig. 7a–c . b, c. Frequency and cell surface phenotype of H2-K d GFP 200-208 tetramer-binding CD8 T cells. d, e. Frequency of IL17A-GFP expressing cells among total lymphocytes and among Vβ4 – (non-Jedi) CD4 T cells. Representative results of two independent experiments (n = 3 chimeras per group). f . T H 17 cells were differentiated in vitro from WT and IL17A-GFP CD4 T cells as in Fig. 7d . Intracellular expression of IL17A cytokine and GFP was analyzed after a short-term PMA/Ionomycin restimulation. Data are presented as the mean ± s.d. with *P < 0.05 and **P < 0.01. Data were analyzed by two-tailed Student’s t test.

Extended Data Fig. 8 IFNγ as an endogenous T/NK/ILC-derived inflammation-associated self-antigen.

a . Expression of Thy1, NK1.1 and MHC II by IFNγ + and total WT thymocytes after PMA/Ionomycin stimulation. b . WT and Ifng –/– mice (on C57BL/6J background) were immunized with IFNγ 69-78 peptide using anti-CD40 and Poly(I:C) as adjuvant. 6 days after immunization, splenocytes were stimulated with IFNγ 69-78 peptide for 6 hours as described in Methods and production of TNF by CD8 T cells was analyzed by flow cytometry. c . WT and Ifng –/– mice (on C57BL/6J background) were lethally irradiated and reconstituted with syngeneic WT or Ifng –/– BM cells depleted of T- and NK-cells. 11 weeks after reconstitution, the resulting four groups of BM chimeras were immunized with IFNγ 69-78 and OVA 257-264 peptides using anti-CD40 and Poly(I:C) as adjuvant. 6 days after immunization, splenocytes were stimulated with OVA 257-264 peptide for 6 hours as described in Methods and production of TNF by CD8 T cells was analyzed by flow cytometry (n = 3 for WT→WT, n = 4 for the other groups). Representative results of two independent experiments. Data are presented as the mean ± s.d. with NS: non-significant ( P > 0.05) and * P < 0.05. Data were analyzed by two-tailed Student’s t test (b) or one-way ANOVA with Holm-Sidak’s multiple comparisons test (c).

Supplementary information

Supplementary information.

Supplementary Figs. 1–4 and Notes.

Reporting Summary

Peer review file, supplementary video 1.

Example of contacts between a CTV- and Cal-520 AM Ca 2+ sensor dye-labeled Jedi-TCRαβ DP cell (green) and a CTY-labeled IL4–GFP iNKT cell (purple) in an RTOC experiment. The contacts resulted in the induction of Ca 2+ signaling (yellow) in the Jedi-TCRαβ DP cell. Time (hh:mm:ss) is shown in the bottom right corner.

Supplementary Video 2

Example of a contact between a CTV- and Cal-520 AM Ca 2+ sensor dye-labeled Jedi-TCRαβ DP cell (green) and a CTY-labeled WT iNKT cell (purple) in an RTOC experiment. Time (hh:mm:ss) is shown in the bottom right corner.

Supplementary Video 3

Example of a long contact between a CTV- and Cal-520 AM Ca 2+ sensor dye-labeled Jedi-TCRαβ DP cell (green) and a CTY-labeled IL4–GFP iNKT cell (purple) in an RTOC experiment. Induction of Ca 2+ signaling (yellow) in the Jedi-TCRαβ DP cell and chasing behavior of a Jedi DP cell toward an iNKT cell could be observed. Time (hh:mm:ss) is shown in the bottom right corner.

Supplementary Video 4

Example of contacts between a CTV- and Cal-520 AM Ca 2+ sensor dye-labeled Jedi-TCRαβ DP cell (green) and a CTY-labeled IL4–GFP iNKT cell (purple) in an RTOC experiment. The contacts resulted in induction of Ca 2+ signaling (yellow) and possible apoptosis in the Jedi-TCRαβ DP cell. Time (hh:mm:ss) is shown in the top right corner.

Supplementary Data 1

Statistical source data for Supplementary Figs. 1–4.

Source Data Figs. 1–8

Statistical source data.

Source Data Extended Data Figs. 2–8.

Rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Cite this article.

You, Y., Dunst, J., Ye, K. et al. Direct presentation of inflammation-associated self-antigens by thymic innate-like T cells induces elimination of autoreactive CD8 + thymocytes. Nat Immunol (2024). https://doi.org/10.1038/s41590-024-01899-6

Download citation

Received : 19 June 2023

Accepted : 17 June 2024

Published : 11 July 2024

DOI : https://doi.org/10.1038/s41590-024-01899-6

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings
• My Bibliography
• Collections
• Citation manager

Save citation to file

Email citation, add to collections.

• Create a new collection
• Add to an existing collection

Add to My Bibliography

Your saved search, create a file for external citation management software, your rss feed.

• Search in PubMed
• Search in NLM Catalog
• Add to Search

Direct presentation of inflammation-associated self-antigens by thymic innate-like T cells induces elimination of autoreactive CD8 + thymocytes

Affiliations.

• 1 Division of Immunology and Allergy, Department of Medicine Solna, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden.
• 2 Center for Molecular Medicine, Karolinska Institutet, Stockholm, Sweden.
• 3 Department of Applied Physics, Science for Life Laboratory, KTH Royal Institute of Technology, Stockholm, Sweden.
• 4 Institute of Immunology, Hannover Medical School, Hannover, Germany.
• 5 Division of Rheumatology, Department of Medicine Solna, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden.
• 6 Max Planck Research Group, Würzburg Institute of Systems Immunology, Julius-Maximilians-Universität Würzburg, Würzburg, Germany.
• 7 Department of Medicine, Division of Immunology and Rheumatology, Stanford University, Stanford, CA, USA.
• 8 Epigenetic Factors in Normal and Malignant Hematopoiesis Lab, CRCM, CNRS, INSERM, Institut Paoli Calmettes, Aix Marseille University, Marseille, France.
• 9 Equipe Labellisée Ligue Nationale Contre le Cancer, Paris, France.
• 10 Department of Cancer Immunology and Virology, Dana-Farber Cancer Institute, Boston, MA, USA.
• 11 Parker Institute for Cancer Immunotherapy, Dana-Farber Cancer Institute, Boston, MA, USA.
• 12 Department of Immunology, Harvard Medical School, Boston, MA, USA.
• 13 Ludwig Center at Harvard, Boston, MA, USA.
• 14 The Precision Immunology Institute, Icahn School of Medicine at Mount Sinai, New York, NY, USA.
• 15 Icahn Genomics Institute, Icahn School of Medicine at Mount Sinai, New York, NY, USA.
• 16 Department of Immunology and Immunotherapy, Icahn School of Medicine at Mount Sinai, New York, NY, USA.
• 17 Institute for Immunity, Transplantation and Infection, Stanford University School of Medicine, Stanford, CA, USA.
• 18 Hamburg Center for Translational Immunology (HCTI), University Medical Center Hamburg-Eppendorf, Hamburg, Germany.
• 19 Institute of Systems Immunology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany.
• 20 Center for Infectious Medicine, Department of Medicine Huddinge, Karolinska Institutet, Stockholm, Sweden.
• 21 Division of Immunology and Allergy, Department of Medicine Solna, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden. [email protected].
• 22 Center for Molecular Medicine, Karolinska Institutet, Stockholm, Sweden. [email protected].
• PMID: 38992254
• DOI: 10.1038/s41590-024-01899-6

Upregulation of diverse self-antigens that constitute components of the inflammatory response overlaps spatially and temporally with the emergence of pathogen-derived foreign antigens. Therefore, discrimination between these inflammation-associated self-antigens and pathogen-derived molecules represents a unique challenge for the adaptive immune system. Here, we demonstrate that CD8 + T cell tolerance to T cell-derived inflammation-associated self-antigens is efficiently induced in the thymus and supported by redundancy in cell types expressing these molecules. In addition to thymic epithelial cells, this included thymic eosinophils and innate-like T cells, a population that expressed molecules characteristic for all major activated T cell subsets. We show that direct T cell-to-T cell antigen presentation by minute numbers of innate-like T cells was sufficient to eliminate autoreactive CD8 + thymocytes. Tolerance to such effector molecules was of critical importance, as its breach caused by decreased thymic abundance of a single model inflammation-associated self-antigen resulted in autoimmune elimination of an entire class of effector T cells.

© 2024. The Author(s).

PubMed Disclaimer

• Kyewski, B. & Derbinski, J. Self-representation in the thymus: an extended view. Nat. Rev. Immunol. 4, 688–698 (2004). - PubMed - DOI
• Anderson, M. S. et al. Projection of an immunological self shadow within the thymus by the AIRE protein. Science 298, 1395–1401 (2002). - PubMed - DOI
• Takaba, H. et al. Fezf2 orchestrates a thymic program of self-antigen expression for immune tolerance. Cell 163, 975–987 (2015). - PubMed - DOI
• Michelson, D. A., Hase, K., Kaisho, T., Benoist, C. & Mathis, D. Thymic epithelial cells co-opt lineage-defining transcription factors to eliminate autoreactive T cells. Cell 185, 2542–2558 (2022). - PubMed - PMC - DOI
• Miller, C. N. et al. Thymic tuft cells promote an IL-4-enriched medulla and shape thymocyte development. Nature 559, 627–631 (2018). - PubMed - PMC - DOI

Grants and funding

• 21 1602 Pj/Cancerfonden (Swedish Cancer Society)
• PR2021-017/Barncancerfonden (Swedish Childhood Cancer Foundation)
• PR2023-0091/Barncancerfonden (Swedish Childhood Cancer Foundation)
• 211192/Radiumhemmets Forskningsfonder (Cancer Research Foundations of Radiumhemmet)
• 231233/Radiumhemmets Forskningsfonder (Cancer Research Foundations of Radiumhemmet)
• DU 1964/1-1/Deutsche Forschungsgemeinschaft (German Research Foundation)

LinkOut - more resources

Research materials.

• NCI CPTC Antibody Characterization Program
• Citation Manager

NCBI Literature Resources

MeSH PMC Bookshelf Disclaimer

The PubMed wordmark and PubMed logo are registered trademarks of the U.S. Department of Health and Human Services (HHS). Unauthorized use of these marks is strictly prohibited.